FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633407_at:

>probe:Drosophila_2:1633407_at:393:25; Interrogation_Position=1620; Antisense; ATAGGATCACACTGAAGTCCCAACC
>probe:Drosophila_2:1633407_at:585:127; Interrogation_Position=1642; Antisense; ACCAGAATCAGAACATCAGCCTTTG
>probe:Drosophila_2:1633407_at:15:35; Interrogation_Position=1656; Antisense; ATCAGCCTTTGTTTCGTAGTACTTA
>probe:Drosophila_2:1633407_at:20:311; Interrogation_Position=1682; Antisense; GCCAATTGTTGCATTTAACAGCGGA
>probe:Drosophila_2:1633407_at:171:189; Interrogation_Position=1698; Antisense; AACAGCGGATGGAATGTGGCCACTT
>probe:Drosophila_2:1633407_at:261:523; Interrogation_Position=1713; Antisense; GTGGCCACTTAAATTACTGCAACAA
>probe:Drosophila_2:1633407_at:66:459; Interrogation_Position=1773; Antisense; GATTTAGCGGTTTTCTATCTTAACT
>probe:Drosophila_2:1633407_at:153:475; Interrogation_Position=1806; Antisense; GTTATGGGTTCTATGATTTCAAAGC
>probe:Drosophila_2:1633407_at:589:173; Interrogation_Position=1857; Antisense; AAAGCGGGCCTGTATCAACCGATTT
>probe:Drosophila_2:1633407_at:332:201; Interrogation_Position=1873; Antisense; AACCGATTTGACCACACATATATAG
>probe:Drosophila_2:1633407_at:637:341; Interrogation_Position=1988; Antisense; GCTTTACTTTGTTGAAACTCTGCAG
>probe:Drosophila_2:1633407_at:647:389; Interrogation_Position=2092; Antisense; GAAACTGTTTCGATGCTTAATATGT
>probe:Drosophila_2:1633407_at:141:121; Interrogation_Position=2146; Antisense; AGCTGTACGATAATTTCTCCCTTGA
>probe:Drosophila_2:1633407_at:224:15; Interrogation_Position=2158; Antisense; ATTTCTCCCTTGATTAACTACCAAT

Paste this into a BLAST search page for me
ATAGGATCACACTGAAGTCCCAACCACCAGAATCAGAACATCAGCCTTTGATCAGCCTTTGTTTCGTAGTACTTAGCCAATTGTTGCATTTAACAGCGGAAACAGCGGATGGAATGTGGCCACTTGTGGCCACTTAAATTACTGCAACAAGATTTAGCGGTTTTCTATCTTAACTGTTATGGGTTCTATGATTTCAAAGCAAAGCGGGCCTGTATCAACCGATTTAACCGATTTGACCACACATATATAGGCTTTACTTTGTTGAAACTCTGCAGGAAACTGTTTCGATGCTTAATATGTAGCTGTACGATAATTTCTCCCTTGAATTTCTCCCTTGATTAACTACCAAT

Full Affymetrix probeset data:

Annotations for 1633407_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720