FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633408_at:

>probe:Drosophila_2:1633408_at:570:709; Interrogation_Position=205; Antisense; TTCAAGAAGATCGTGCCCATCTCTC
>probe:Drosophila_2:1633408_at:521:37; Interrogation_Position=223; Antisense; ATCTCTCTGATCCTGCTGAAGTCAA
>probe:Drosophila_2:1633408_at:105:139; Interrogation_Position=257; Antisense; ACGAGGCCGAGCTGGTGCCCGTCTA
>probe:Drosophila_2:1633408_at:117:129; Interrogation_Position=286; Antisense; ACCGATCAGATTCCCGAGAACGTTC
>probe:Drosophila_2:1633408_at:349:423; Interrogation_Position=301; Antisense; GAGAACGTTCAGTTCATCCCGACAC
>probe:Drosophila_2:1633408_at:118:399; Interrogation_Position=321; Antisense; GACACCCAATGGAATTTCCGGTCAC
>probe:Drosophila_2:1633408_at:548:631; Interrogation_Position=337; Antisense; TCCGGTCACAAGGATGTCCAGGCCA
>probe:Drosophila_2:1633408_at:464:413; Interrogation_Position=385; Antisense; GACCAGCTGCAGATCAACGGTCTGT
>probe:Drosophila_2:1633408_at:429:197; Interrogation_Position=400; Antisense; AACGGTCTGTCCAACCTGGAGAACA
>probe:Drosophila_2:1633408_at:496:643; Interrogation_Position=452; Antisense; TCTCGGCTGCCGACAATGAAGGCGA
>probe:Drosophila_2:1633408_at:606:453; Interrogation_Position=550; Antisense; GATCAGCTGTTAGACGGAGCCGCTC
>probe:Drosophila_2:1633408_at:411:89; Interrogation_Position=679; Antisense; AGCGTGGAGGAGATACCCCTGCTTC
>probe:Drosophila_2:1633408_at:699:617; Interrogation_Position=698; Antisense; TGCTTCTGTACTCCGCCAACGAGGG
>probe:Drosophila_2:1633408_at:592:389; Interrogation_Position=737; Antisense; GAAACTCGGGACGTCGCTTTGTGGC

Paste this into a BLAST search page for me
TTCAAGAAGATCGTGCCCATCTCTCATCTCTCTGATCCTGCTGAAGTCAAACGAGGCCGAGCTGGTGCCCGTCTAACCGATCAGATTCCCGAGAACGTTCGAGAACGTTCAGTTCATCCCGACACGACACCCAATGGAATTTCCGGTCACTCCGGTCACAAGGATGTCCAGGCCAGACCAGCTGCAGATCAACGGTCTGTAACGGTCTGTCCAACCTGGAGAACATCTCGGCTGCCGACAATGAAGGCGAGATCAGCTGTTAGACGGAGCCGCTCAGCGTGGAGGAGATACCCCTGCTTCTGCTTCTGTACTCCGCCAACGAGGGGAAACTCGGGACGTCGCTTTGTGGC

Full Affymetrix probeset data:

Annotations for 1633408_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720