Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633409_a_at:

>probe:Drosophila_2:1633409_a_at:257:287; Interrogation_Position=302; Antisense; CTGGCGGCATCGGACAGCTGCTGCA
>probe:Drosophila_2:1633409_a_at:216:455; Interrogation_Position=473; Antisense; GATACTCCGGCGGTGGTGGATACTC
>probe:Drosophila_2:1633409_a_at:406:669; Interrogation_Position=511; Antisense; TACTCTGGCGGATATGCTGCTCCCA
>probe:Drosophila_2:1633409_a_at:66:1; Interrogation_Position=532; Antisense; CCCAGGCCCGTTGAGAAGGTTGTCA
>probe:Drosophila_2:1633409_a_at:624:371; Interrogation_Position=561; Antisense; GAAGGTCATTAACGAAGGCTACTCT
>probe:Drosophila_2:1633409_a_at:356:371; Interrogation_Position=574; Antisense; GAAGGCTACTCTGGCGGTTACTCCG
>probe:Drosophila_2:1633409_a_at:582:297; Interrogation_Position=600; Antisense; CGCTCAGTCTGGTGGCTACTCCGGT
>probe:Drosophila_2:1633409_a_at:381:629; Interrogation_Position=619; Antisense; TCCGGTGGTTACTCCGGCGCTCAGT
>probe:Drosophila_2:1633409_a_at:233:337; Interrogation_Position=637; Antisense; GCTCAGTCTGGTGGCTACTCTGGTG
>probe:Drosophila_2:1633409_a_at:552:669; Interrogation_Position=652; Antisense; TACTCTGGTGGCTATTCCGGCGCTC
>probe:Drosophila_2:1633409_a_at:255:305; Interrogation_Position=683; Antisense; CCGGCTGGAACAAGGGCTGGTAAAT
>probe:Drosophila_2:1633409_a_at:136:551; Interrogation_Position=710; Antisense; GGAGCAAGCCAATATGGACCAACTA
>probe:Drosophila_2:1633409_a_at:470:471; Interrogation_Position=741; Antisense; GTTCAAACTGCCAAACCGAAAGCCA
>probe:Drosophila_2:1633409_a_at:364:311; Interrogation_Position=762; Antisense; GCCAAGCAGCTTAGGATTTAATATT

Paste this into a BLAST search page for me
CTGGCGGCATCGGACAGCTGCTGCAGATACTCCGGCGGTGGTGGATACTCTACTCTGGCGGATATGCTGCTCCCACCCAGGCCCGTTGAGAAGGTTGTCAGAAGGTCATTAACGAAGGCTACTCTGAAGGCTACTCTGGCGGTTACTCCGCGCTCAGTCTGGTGGCTACTCCGGTTCCGGTGGTTACTCCGGCGCTCAGTGCTCAGTCTGGTGGCTACTCTGGTGTACTCTGGTGGCTATTCCGGCGCTCCCGGCTGGAACAAGGGCTGGTAAATGGAGCAAGCCAATATGGACCAACTAGTTCAAACTGCCAAACCGAAAGCCAGCCAAGCAGCTTAGGATTTAATATT

Full Affymetrix probeset data:

Annotations for 1633409_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime