FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633410_at:

>probe:Drosophila_2:1633410_at:14:307; Interrogation_Position=1031; Antisense; CCAGTTCTAGGCCAATGTCGATTAA
>probe:Drosophila_2:1633410_at:321:561; Interrogation_Position=1074; Antisense; GGAAAACGGCCATATTGCTCTCATT
>probe:Drosophila_2:1633410_at:161:255; Interrogation_Position=1137; Antisense; CAGAACCAAGACCACTTCCAAGTTT
>probe:Drosophila_2:1633410_at:56:185; Interrogation_Position=589; Antisense; AACAAGTTCCGCCAGCATGTAAAAG
>probe:Drosophila_2:1633410_at:555:595; Interrogation_Position=642; Antisense; TGTGCTGAGTAAAATGGCCCTCCAT
>probe:Drosophila_2:1633410_at:343:321; Interrogation_Position=658; Antisense; GCCCTCCATCGGCTGATTAAACTGG
>probe:Drosophila_2:1633410_at:205:189; Interrogation_Position=691; Antisense; AACAGCAGCATTTGCACCAATCGCA
>probe:Drosophila_2:1633410_at:80:529; Interrogation_Position=796; Antisense; GGGTTAAGTCGCTTCATTCCTTTCT
>probe:Drosophila_2:1633410_at:194:543; Interrogation_Position=849; Antisense; GGATTGGTACCAGCCACTACTCTAC
>probe:Drosophila_2:1633410_at:398:85; Interrogation_Position=895; Antisense; AGTGACTGCTGCTCAAATACGGCCA
>probe:Drosophila_2:1633410_at:374:161; Interrogation_Position=909; Antisense; AAATACGGCCATCTCGTTTCACTAC
>probe:Drosophila_2:1633410_at:287:479; Interrogation_Position=924; Antisense; GTTTCACTACAACAACGCACAGGAG
>probe:Drosophila_2:1633410_at:92:269; Interrogation_Position=943; Antisense; CAGGAGTTCTACGTGCTCGAATATA
>probe:Drosophila_2:1633410_at:593:179; Interrogation_Position=996; Antisense; AAACAGAGAACTTGGTCCACTGCCA

Paste this into a BLAST search page for me
CCAGTTCTAGGCCAATGTCGATTAAGGAAAACGGCCATATTGCTCTCATTCAGAACCAAGACCACTTCCAAGTTTAACAAGTTCCGCCAGCATGTAAAAGTGTGCTGAGTAAAATGGCCCTCCATGCCCTCCATCGGCTGATTAAACTGGAACAGCAGCATTTGCACCAATCGCAGGGTTAAGTCGCTTCATTCCTTTCTGGATTGGTACCAGCCACTACTCTACAGTGACTGCTGCTCAAATACGGCCAAAATACGGCCATCTCGTTTCACTACGTTTCACTACAACAACGCACAGGAGCAGGAGTTCTACGTGCTCGAATATAAAACAGAGAACTTGGTCCACTGCCA

Full Affymetrix probeset data:

Annotations for 1633410_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720