Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633411_s_at:

>probe:Drosophila_2:1633411_s_at:374:47; Interrogation_Position=225; Antisense; ATCCTCTTCCTCTGCGGAGGCCAGG
>probe:Drosophila_2:1633411_s_at:694:115; Interrogation_Position=28; Antisense; AGCATGCGCTTCTCGATCGTAATTG
>probe:Drosophila_2:1633411_s_at:102:123; Interrogation_Position=302; Antisense; AGCGCAGAAGGCAGCGCAGGACTCA
>probe:Drosophila_2:1633411_s_at:353:75; Interrogation_Position=319; Antisense; AGGACTCAGAGGCTGCGCCAGCAAC
>probe:Drosophila_2:1633411_s_at:110:313; Interrogation_Position=335; Antisense; GCCAGCAACTGGAGAATCAACGTCG
>probe:Drosophila_2:1633411_s_at:435:33; Interrogation_Position=350; Antisense; ATCAACGTCGACAGATCAACCAGCT
>probe:Drosophila_2:1633411_s_at:92:309; Interrogation_Position=369; Antisense; CCAGCTGAGCGGATGAAGGTCTTCG
>probe:Drosophila_2:1633411_s_at:463:79; Interrogation_Position=385; Antisense; AGGTCTTCGGAAAGACTCGGCTTAT
>probe:Drosophila_2:1633411_s_at:225:405; Interrogation_Position=398; Antisense; GACTCGGCTTATGACAATTTAGGAA
>probe:Drosophila_2:1633411_s_at:350:445; Interrogation_Position=42; Antisense; GATCGTAATTGTTCTTTCCGTCCTA
>probe:Drosophila_2:1633411_s_at:102:13; Interrogation_Position=450; Antisense; ATTCTTTCATTGTTCAAGTTCGCCA
>probe:Drosophila_2:1633411_s_at:671:273; Interrogation_Position=457; Antisense; CATTGTTCAAGTTCGCCAAGATAAT
>probe:Drosophila_2:1633411_s_at:479:3; Interrogation_Position=49; Antisense; ATTGTTCTTTCCGTCCTAGGATGCC
>probe:Drosophila_2:1633411_s_at:685:679; Interrogation_Position=65; Antisense; TAGGATGCCTCCTGCTTAGCCAGGA

Paste this into a BLAST search page for me
ATCCTCTTCCTCTGCGGAGGCCAGGAGCATGCGCTTCTCGATCGTAATTGAGCGCAGAAGGCAGCGCAGGACTCAAGGACTCAGAGGCTGCGCCAGCAACGCCAGCAACTGGAGAATCAACGTCGATCAACGTCGACAGATCAACCAGCTCCAGCTGAGCGGATGAAGGTCTTCGAGGTCTTCGGAAAGACTCGGCTTATGACTCGGCTTATGACAATTTAGGAAGATCGTAATTGTTCTTTCCGTCCTAATTCTTTCATTGTTCAAGTTCGCCACATTGTTCAAGTTCGCCAAGATAATATTGTTCTTTCCGTCCTAGGATGCCTAGGATGCCTCCTGCTTAGCCAGGA

Full Affymetrix probeset data:

Annotations for 1633411_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime