Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633414_at:

>probe:Drosophila_2:1633414_at:689:371; Interrogation_Position=1051; Antisense; GAAGTCTCACCGAAACCGTGTCGAA
>probe:Drosophila_2:1633414_at:422:75; Interrogation_Position=1184; Antisense; AGGAGCCGCCCAGCAAAGGAGCTAG
>probe:Drosophila_2:1633414_at:119:419; Interrogation_Position=1202; Antisense; GAGCTAGTGACTCGCAGGACTCGCA
>probe:Drosophila_2:1633414_at:669:403; Interrogation_Position=1219; Antisense; GACTCGCAGGAATCGCTGGACAGCA
>probe:Drosophila_2:1633414_at:722:365; Interrogation_Position=1285; Antisense; GAATCACAGCTGGAATCGCCGTACT
>probe:Drosophila_2:1633414_at:119:663; Interrogation_Position=1306; Antisense; TACTCGACGACCTCCGATGGACTGA
>probe:Drosophila_2:1633414_at:171:609; Interrogation_Position=1328; Antisense; TGACCCGGATGCGATGCACCATTAA
>probe:Drosophila_2:1633414_at:188:111; Interrogation_Position=1364; Antisense; AGCAAGTGCCCTTCAACTGTATGGA
>probe:Drosophila_2:1633414_at:203:121; Interrogation_Position=1417; Antisense; AGCGAGCCCATATTGAACACCATTC
>probe:Drosophila_2:1633414_at:716:125; Interrogation_Position=1435; Antisense; ACCATTCTAGGTCTGAGCTACGCCA
>probe:Drosophila_2:1633414_at:134:273; Interrogation_Position=1461; Antisense; CTTTCAGCAACTAATGGGTCCCTTT
>probe:Drosophila_2:1633414_at:327:661; Interrogation_Position=1524; Antisense; TAGTATGCAAAGCTCCTACTTCCGG
>probe:Drosophila_2:1633414_at:356:235; Interrogation_Position=1562; Antisense; AATCCTACGGCGAATGCGGCGTCAA
>probe:Drosophila_2:1633414_at:680:573; Interrogation_Position=1579; Antisense; GGCGTCAAGGACTCCATGGATCACT

Paste this into a BLAST search page for me
GAAGTCTCACCGAAACCGTGTCGAAAGGAGCCGCCCAGCAAAGGAGCTAGGAGCTAGTGACTCGCAGGACTCGCAGACTCGCAGGAATCGCTGGACAGCAGAATCACAGCTGGAATCGCCGTACTTACTCGACGACCTCCGATGGACTGATGACCCGGATGCGATGCACCATTAAAGCAAGTGCCCTTCAACTGTATGGAAGCGAGCCCATATTGAACACCATTCACCATTCTAGGTCTGAGCTACGCCACTTTCAGCAACTAATGGGTCCCTTTTAGTATGCAAAGCTCCTACTTCCGGAATCCTACGGCGAATGCGGCGTCAAGGCGTCAAGGACTCCATGGATCACT

Full Affymetrix probeset data:

Annotations for 1633414_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime