FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633415_at:

>probe:Drosophila_2:1633415_at:248:371; Interrogation_Position=2043; Antisense; GAAGGGACTGCGGAAAACCCCATAG
>probe:Drosophila_2:1633415_at:19:389; Interrogation_Position=2055; Antisense; GAAAACCCCATAGCCATTCGATTTT
>probe:Drosophila_2:1633415_at:496:27; Interrogation_Position=2064; Antisense; ATAGCCATTCGATTTTCACAAACAA
>probe:Drosophila_2:1633415_at:52:461; Interrogation_Position=2116; Antisense; GATTGGCTGGTTCTAAACAACGGTT
>probe:Drosophila_2:1633415_at:120:273; Interrogation_Position=2179; Antisense; CATATTTTTGTTATAGTGCCTACGG
>probe:Drosophila_2:1633415_at:636:505; Interrogation_Position=2194; Antisense; GTGCCTACGGTGTATAAGACTTTAA
>probe:Drosophila_2:1633415_at:675:185; Interrogation_Position=2288; Antisense; AACAATTCCAGATTCCTAAGAGCCA
>probe:Drosophila_2:1633415_at:264:1; Interrogation_Position=2299; Antisense; ATTCCTAAGAGCCAAAAACCCAATG
>probe:Drosophila_2:1633415_at:409:443; Interrogation_Position=2373; Antisense; GATGTTGAAATATCGCACACATGTT
>probe:Drosophila_2:1633415_at:534:357; Interrogation_Position=2387; Antisense; GCACACATGTTATATGATGCCTCTT
>probe:Drosophila_2:1633415_at:606:657; Interrogation_Position=2498; Antisense; TAAGTTTGAGCAACTAAGCAGGCAA
>probe:Drosophila_2:1633415_at:345:349; Interrogation_Position=2515; Antisense; GCAGGCAAATCAAATGTATCATACG
>probe:Drosophila_2:1633415_at:479:601; Interrogation_Position=2549; Antisense; TGTTATACCACTAATTCACAGGATA
>probe:Drosophila_2:1633415_at:34:53; Interrogation_Position=2614; Antisense; ATGCGGTATACTACTTTTTCATCAC

Paste this into a BLAST search page for me
GAAGGGACTGCGGAAAACCCCATAGGAAAACCCCATAGCCATTCGATTTTATAGCCATTCGATTTTCACAAACAAGATTGGCTGGTTCTAAACAACGGTTCATATTTTTGTTATAGTGCCTACGGGTGCCTACGGTGTATAAGACTTTAAAACAATTCCAGATTCCTAAGAGCCAATTCCTAAGAGCCAAAAACCCAATGGATGTTGAAATATCGCACACATGTTGCACACATGTTATATGATGCCTCTTTAAGTTTGAGCAACTAAGCAGGCAAGCAGGCAAATCAAATGTATCATACGTGTTATACCACTAATTCACAGGATAATGCGGTATACTACTTTTTCATCAC

Full Affymetrix probeset data:

Annotations for 1633415_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720