FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633417_at:

>probe:Drosophila_2:1633417_at:447:689; Interrogation_Position=335; Antisense; TTTGCCCCGTCGATTTTCACAGAAA
>probe:Drosophila_2:1633417_at:653:395; Interrogation_Position=356; Antisense; GAAATTTATGCGCACGCGTTCCGTA
>probe:Drosophila_2:1633417_at:370:293; Interrogation_Position=377; Antisense; CGTATTTTCGCCCACAAGTCAAAGT
>probe:Drosophila_2:1633417_at:644:105; Interrogation_Position=473; Antisense; AGACAGACCAAAGCCGGATATCCGA
>probe:Drosophila_2:1633417_at:690:519; Interrogation_Position=561; Antisense; GTGGAGGACCCAAGAAGTCCCACTC
>probe:Drosophila_2:1633417_at:382:483; Interrogation_Position=589; Antisense; GTATCCATCATTCACGCTATAAGCC
>probe:Drosophila_2:1633417_at:92:533; Interrogation_Position=623; Antisense; GGTGGAGCACCCCACTTTGAGTCCT
>probe:Drosophila_2:1633417_at:265:723; Interrogation_Position=639; Antisense; TTGAGTCCTCGGGTCAAATCCCTGC
>probe:Drosophila_2:1633417_at:273:561; Interrogation_Position=675; Antisense; GGAAACGCGCATCTCACAGAGCTGT
>probe:Drosophila_2:1633417_at:494:155; Interrogation_Position=690; Antisense; ACAGAGCTGTTCACGCGCCAGGAGA
>probe:Drosophila_2:1633417_at:172:529; Interrogation_Position=781; Antisense; GGGAGATCCGATTGGCCATGAATAT
>probe:Drosophila_2:1633417_at:10:55; Interrogation_Position=798; Antisense; ATGAATATTATCCAACTGGCCAAGC
>probe:Drosophila_2:1633417_at:646:287; Interrogation_Position=813; Antisense; CTGGCCAAGCAATTCTTCTGATTTT
>probe:Drosophila_2:1633417_at:721:679; Interrogation_Position=839; Antisense; TATCCTGTAGGATTTCTGCTAATTT

Paste this into a BLAST search page for me
TTTGCCCCGTCGATTTTCACAGAAAGAAATTTATGCGCACGCGTTCCGTACGTATTTTCGCCCACAAGTCAAAGTAGACAGACCAAAGCCGGATATCCGAGTGGAGGACCCAAGAAGTCCCACTCGTATCCATCATTCACGCTATAAGCCGGTGGAGCACCCCACTTTGAGTCCTTTGAGTCCTCGGGTCAAATCCCTGCGGAAACGCGCATCTCACAGAGCTGTACAGAGCTGTTCACGCGCCAGGAGAGGGAGATCCGATTGGCCATGAATATATGAATATTATCCAACTGGCCAAGCCTGGCCAAGCAATTCTTCTGATTTTTATCCTGTAGGATTTCTGCTAATTT

Full Affymetrix probeset data:

Annotations for 1633417_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720