FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633418_at:

>probe:Drosophila_2:1633418_at:297:369; Interrogation_Position=1099; Antisense; GAATGCTCAGCATTGCTTCCACTCT
>probe:Drosophila_2:1633418_at:13:309; Interrogation_Position=1133; Antisense; CCAGCTCACGGTGGGCTTCGAACTG
>probe:Drosophila_2:1633418_at:380:341; Interrogation_Position=1147; Antisense; GCTTCGAACTGGACGGCGATGCCGT
>probe:Drosophila_2:1633418_at:273:553; Interrogation_Position=1202; Antisense; GGAGCTACCCAATGTTGACTGCGTG
>probe:Drosophila_2:1633418_at:10:111; Interrogation_Position=1264; Antisense; AGAAGTCCTTTGACACGGTGCTGAT
>probe:Drosophila_2:1633418_at:189:235; Interrogation_Position=1314; Antisense; AATGCCGGCATGGACATGCGGTTTC
>probe:Drosophila_2:1633418_at:366:51; Interrogation_Position=1329; Antisense; ATGCGGTTTCTGGAGGTGGCCCTAC
>probe:Drosophila_2:1633418_at:268:141; Interrogation_Position=1352; Antisense; ACGGTTGGCCAACAGAGCAGTTTAC
>probe:Drosophila_2:1633418_at:4:103; Interrogation_Position=1365; Antisense; AGAGCAGTTTACTCCCTACACAAGA
>probe:Drosophila_2:1633418_at:110:409; Interrogation_Position=1388; Antisense; GACGTCAACACGGTCGTACATTCAG
>probe:Drosophila_2:1633418_at:539:535; Interrogation_Position=1447; Antisense; TGGTCGCCGAACTCCGGTACAACAT
>probe:Drosophila_2:1633418_at:598:295; Interrogation_Position=1472; Antisense; CGACGCCAGCTACAAGTTTCACAAG
>probe:Drosophila_2:1633418_at:78:21; Interrogation_Position=1510; Antisense; ATATTGAGGTGGACTTCTGGCGCTT
>probe:Drosophila_2:1633418_at:468:641; Interrogation_Position=1525; Antisense; TCTGGCGCTTTGAAATCGGCACGGA

Paste this into a BLAST search page for me
GAATGCTCAGCATTGCTTCCACTCTCCAGCTCACGGTGGGCTTCGAACTGGCTTCGAACTGGACGGCGATGCCGTGGAGCTACCCAATGTTGACTGCGTGAGAAGTCCTTTGACACGGTGCTGATAATGCCGGCATGGACATGCGGTTTCATGCGGTTTCTGGAGGTGGCCCTACACGGTTGGCCAACAGAGCAGTTTACAGAGCAGTTTACTCCCTACACAAGAGACGTCAACACGGTCGTACATTCAGTGGTCGCCGAACTCCGGTACAACATCGACGCCAGCTACAAGTTTCACAAGATATTGAGGTGGACTTCTGGCGCTTTCTGGCGCTTTGAAATCGGCACGGA

Full Affymetrix probeset data:

Annotations for 1633418_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720