Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633419_s_at:

>probe:Drosophila_2:1633419_s_at:68:415; Interrogation_Position=1056; Antisense; GACCAGGATGCATCTTCGGCAGCTA
>probe:Drosophila_2:1633419_s_at:660:27; Interrogation_Position=1127; Antisense; ATACGGATGGCATTGTGCCTCCCAT
>probe:Drosophila_2:1633419_s_at:235:307; Interrogation_Position=1148; Antisense; CCATTCCGTCATTCCTAAAGATCTT
>probe:Drosophila_2:1633419_s_at:441:565; Interrogation_Position=1176; Antisense; GGCAAACTATTCACCGCAGAGTGGT
>probe:Drosophila_2:1633419_s_at:316:83; Interrogation_Position=1195; Antisense; AGTGGTGCAGTGGTCTCAAGGATTA
>probe:Drosophila_2:1633419_s_at:55:399; Interrogation_Position=1238; Antisense; GACAGCCGAAGCAAGGACCCTATCA
>probe:Drosophila_2:1633419_s_at:152:371; Interrogation_Position=1277; Antisense; GAAGGGCCTTTGAATTTGTGAACGA
>probe:Drosophila_2:1633419_s_at:122:251; Interrogation_Position=1357; Antisense; CAAGTCGTGTAGCTGTTGTTCCGCA
>probe:Drosophila_2:1633419_s_at:501:355; Interrogation_Position=1379; Antisense; GCACAGTGCCCCTAGGAGTTTTATT
>probe:Drosophila_2:1633419_s_at:505:95; Interrogation_Position=850; Antisense; AGATTGGCACACACAAGTCTTCGCG
>probe:Drosophila_2:1633419_s_at:99:291; Interrogation_Position=873; Antisense; CGGGCATATTCATTTGGGCGACCAC
>probe:Drosophila_2:1633419_s_at:42:347; Interrogation_Position=923; Antisense; GCATCGATCTGGAGCGTTTTCTGGA
>probe:Drosophila_2:1633419_s_at:127:659; Interrogation_Position=959; Antisense; TACCAAGGGTTTTCGTCAGCGGTTG
>probe:Drosophila_2:1633419_s_at:635:715; Interrogation_Position=981; Antisense; TTGCCCGACGGACTTTAATCACTAT

Paste this into a BLAST search page for me
GACCAGGATGCATCTTCGGCAGCTAATACGGATGGCATTGTGCCTCCCATCCATTCCGTCATTCCTAAAGATCTTGGCAAACTATTCACCGCAGAGTGGTAGTGGTGCAGTGGTCTCAAGGATTAGACAGCCGAAGCAAGGACCCTATCAGAAGGGCCTTTGAATTTGTGAACGACAAGTCGTGTAGCTGTTGTTCCGCAGCACAGTGCCCCTAGGAGTTTTATTAGATTGGCACACACAAGTCTTCGCGCGGGCATATTCATTTGGGCGACCACGCATCGATCTGGAGCGTTTTCTGGATACCAAGGGTTTTCGTCAGCGGTTGTTGCCCGACGGACTTTAATCACTAT

Full Affymetrix probeset data:

Annotations for 1633419_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime