FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633420_at:

>probe:Drosophila_2:1633420_at:209:107; Interrogation_Position=2504; Antisense; AGAACTCATCAAACTGTGGCCACAG
>probe:Drosophila_2:1633420_at:707:231; Interrogation_Position=2640; Antisense; AATGAGCGGCTCAACGGAAGACAAA
>probe:Drosophila_2:1633420_at:46:669; Interrogation_Position=2710; Antisense; TACATTACAGCTTGAGTTCCTCGGT
>probe:Drosophila_2:1633420_at:699:637; Interrogation_Position=2730; Antisense; TCGGTGTCCGGTAGCTTGCGGAAAA
>probe:Drosophila_2:1633420_at:91:389; Interrogation_Position=2750; Antisense; GAAAAACCACTGCACATGTTCCTCA
>probe:Drosophila_2:1633420_at:529:59; Interrogation_Position=2765; Antisense; ATGTTCCTCAGTGACATCGGCCAGC
>probe:Drosophila_2:1633420_at:340:571; Interrogation_Position=2808; Antisense; GGCTTCTGATCCTTGTCGATGAGTA
>probe:Drosophila_2:1633420_at:323:725; Interrogation_Position=2850; Antisense; TTGAAATCACTTCGCTCCAGATGAC
>probe:Drosophila_2:1633420_at:532:355; Interrogation_Position=2875; Antisense; GCACGGCCAGACGATATTCCATAAT
>probe:Drosophila_2:1633420_at:26:33; Interrogation_Position=2898; Antisense; ATAAGACACTGAGCCAGCGACAGCT
>probe:Drosophila_2:1633420_at:201:513; Interrogation_Position=2923; Antisense; GTGATCCGAGCTCCAACTGACGGAA
>probe:Drosophila_2:1633420_at:139:611; Interrogation_Position=2940; Antisense; TGACGGAACGTAACCTTCATCGAGG
>probe:Drosophila_2:1633420_at:234:307; Interrogation_Position=2953; Antisense; CCTTCATCGAGGTGGGAGACATCTT
>probe:Drosophila_2:1633420_at:401:551; Interrogation_Position=2967; Antisense; GGAGACATCTTCGAGAGCGTCTAAA

Paste this into a BLAST search page for me
AGAACTCATCAAACTGTGGCCACAGAATGAGCGGCTCAACGGAAGACAAATACATTACAGCTTGAGTTCCTCGGTTCGGTGTCCGGTAGCTTGCGGAAAAGAAAAACCACTGCACATGTTCCTCAATGTTCCTCAGTGACATCGGCCAGCGGCTTCTGATCCTTGTCGATGAGTATTGAAATCACTTCGCTCCAGATGACGCACGGCCAGACGATATTCCATAATATAAGACACTGAGCCAGCGACAGCTGTGATCCGAGCTCCAACTGACGGAATGACGGAACGTAACCTTCATCGAGGCCTTCATCGAGGTGGGAGACATCTTGGAGACATCTTCGAGAGCGTCTAAA

Full Affymetrix probeset data:

Annotations for 1633420_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720