FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633421_at:

>probe:Drosophila_2:1633421_at:399:37; Interrogation_Position=1036; Antisense; ATCTACCATTTCATCCCATCATTGA
>probe:Drosophila_2:1633421_at:429:593; Interrogation_Position=537; Antisense; TGGGATGTAGCCAGTTGCCCGAACA
>probe:Drosophila_2:1633421_at:664:595; Interrogation_Position=577; Antisense; TGTGCTCAATATTTCCATCGACGGG
>probe:Drosophila_2:1633421_at:274:635; Interrogation_Position=594; Antisense; TCGACGGGATGGAACCTATCGTTTT
>probe:Drosophila_2:1633421_at:639:577; Interrogation_Position=633; Antisense; GGCCGCATGTAGACGAGTTCCTGGA
>probe:Drosophila_2:1633421_at:683:555; Interrogation_Position=655; Antisense; GGACTTTGTGTCCAAGTGGTACGAC
>probe:Drosophila_2:1633421_at:696:485; Interrogation_Position=673; Antisense; GTACGACCTGGTGATCTATACGGCC
>probe:Drosophila_2:1633421_at:291:687; Interrogation_Position=689; Antisense; TATACGGCCAGCCTGGAGGTCTATG
>probe:Drosophila_2:1633421_at:459:683; Interrogation_Position=710; Antisense; TATGCCGCCCAGGTTGTGGACCATC
>probe:Drosophila_2:1633421_at:123:79; Interrogation_Position=748; Antisense; AGGATTGATTACTCGCCGCTTCTAT
>probe:Drosophila_2:1633421_at:410:609; Interrogation_Position=816; Antisense; TGACATTGGTCACCCCTGACATGAG
>probe:Drosophila_2:1633421_at:620:417; Interrogation_Position=838; Antisense; GAGCGGCGTTTTAATCATCGACAAC
>probe:Drosophila_2:1633421_at:505:197; Interrogation_Position=893; Antisense; AACGCTATTCCCATTAAGACCTTCA
>probe:Drosophila_2:1633421_at:45:399; Interrogation_Position=932; Antisense; GACACGGAGCTCCTGAAGATGCTGC

Paste this into a BLAST search page for me
ATCTACCATTTCATCCCATCATTGATGGGATGTAGCCAGTTGCCCGAACATGTGCTCAATATTTCCATCGACGGGTCGACGGGATGGAACCTATCGTTTTGGCCGCATGTAGACGAGTTCCTGGAGGACTTTGTGTCCAAGTGGTACGACGTACGACCTGGTGATCTATACGGCCTATACGGCCAGCCTGGAGGTCTATGTATGCCGCCCAGGTTGTGGACCATCAGGATTGATTACTCGCCGCTTCTATTGACATTGGTCACCCCTGACATGAGGAGCGGCGTTTTAATCATCGACAACAACGCTATTCCCATTAAGACCTTCAGACACGGAGCTCCTGAAGATGCTGC

Full Affymetrix probeset data:

Annotations for 1633421_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720