FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633424_at:

>probe:Drosophila_2:1633424_at:95:257; Interrogation_Position=1014; Antisense; CACATGCCGCGTTTACGATGGGTGA
>probe:Drosophila_2:1633424_at:369:71; Interrogation_Position=466; Antisense; AGTCGCGTGGGCTCCAAGACGGATT
>probe:Drosophila_2:1633424_at:78:213; Interrogation_Position=481; Antisense; AAGACGGATTTCATTCTTCCACCGG
>probe:Drosophila_2:1633424_at:197:209; Interrogation_Position=578; Antisense; AAGCATCGCGATCCGAATCCATATA
>probe:Drosophila_2:1633424_at:542:559; Interrogation_Position=635; Antisense; GGAAACGCCTTACCCTGTGCAATTA
>probe:Drosophila_2:1633424_at:591:613; Interrogation_Position=652; Antisense; TGCAATTACAACACCGGCGACAAGT
>probe:Drosophila_2:1633424_at:465:195; Interrogation_Position=696; Antisense; AACGGTGGTTCCCAATCACACAGTG
>probe:Drosophila_2:1633424_at:219:559; Interrogation_Position=779; Antisense; GGACAACGAAGTATACGCTGCTCTC
>probe:Drosophila_2:1633424_at:403:335; Interrogation_Position=795; Antisense; GCTGCTCTCGTTCATACCGAAGAAT
>probe:Drosophila_2:1633424_at:98:553; Interrogation_Position=825; Antisense; GGAGCAATTCCATCGTGTGGCCAAC
>probe:Drosophila_2:1633424_at:219:483; Interrogation_Position=852; Antisense; GTATTTCATTTTCATTGTCCTGCTG
>probe:Drosophila_2:1633424_at:550:5; Interrogation_Position=865; Antisense; ATTGTCCTGCTGAATTGGGTGCCGG
>probe:Drosophila_2:1633424_at:43:75; Interrogation_Position=908; Antisense; AGGAGGTGGCCATGATACCGGTCCT
>probe:Drosophila_2:1633424_at:302:517; Interrogation_Position=944; Antisense; GTGTGACTGCTGTAAAGGATCTCTT

Paste this into a BLAST search page for me
CACATGCCGCGTTTACGATGGGTGAAGTCGCGTGGGCTCCAAGACGGATTAAGACGGATTTCATTCTTCCACCGGAAGCATCGCGATCCGAATCCATATAGGAAACGCCTTACCCTGTGCAATTATGCAATTACAACACCGGCGACAAGTAACGGTGGTTCCCAATCACACAGTGGGACAACGAAGTATACGCTGCTCTCGCTGCTCTCGTTCATACCGAAGAATGGAGCAATTCCATCGTGTGGCCAACGTATTTCATTTTCATTGTCCTGCTGATTGTCCTGCTGAATTGGGTGCCGGAGGAGGTGGCCATGATACCGGTCCTGTGTGACTGCTGTAAAGGATCTCTT

Full Affymetrix probeset data:

Annotations for 1633424_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720