FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633425_at:

>probe:Drosophila_2:1633425_at:716:705; Interrogation_Position=1326; Antisense; TTACCGGAATCTACTGCATCTTGGG
>probe:Drosophila_2:1633425_at:520:421; Interrogation_Position=1364; Antisense; GAGAACTTCAACTCCATTCTGCAAG
>probe:Drosophila_2:1633425_at:38:369; Interrogation_Position=1446; Antisense; GAATGCTGGTTCCAAAATCCCATGG
>probe:Drosophila_2:1633425_at:691:81; Interrogation_Position=1472; Antisense; AGGGCCGCTTTAGTTGGAGTTCTCG
>probe:Drosophila_2:1633425_at:174:429; Interrogation_Position=1488; Antisense; GAGTTCTCGCTAGCATTGCCTGTAT
>probe:Drosophila_2:1633425_at:418:627; Interrogation_Position=1504; Antisense; TGCCTGTATGGCCACCATTGTGATT
>probe:Drosophila_2:1633425_at:379:523; Interrogation_Position=1537; Antisense; GGGCCGCAATCACTATGACACTCTG
>probe:Drosophila_2:1633425_at:720:225; Interrogation_Position=1670; Antisense; AAGGAATTCAGCATCCTGGACCTCT
>probe:Drosophila_2:1633425_at:361:637; Interrogation_Position=1692; Antisense; TCTCCTTTAACTGGTACACGGTCAC
>probe:Drosophila_2:1633425_at:220:539; Interrogation_Position=1742; Antisense; GGTATTCCGCTGAGTTACATCCTGA
>probe:Drosophila_2:1633425_at:210:151; Interrogation_Position=1758; Antisense; ACATCCTGAAGTCTGGGCCTGATTA
>probe:Drosophila_2:1633425_at:75:309; Interrogation_Position=1774; Antisense; GCCTGATTACAAACCGAACCCGAAG
>probe:Drosophila_2:1633425_at:125:121; Interrogation_Position=1818; Antisense; AGCCGTTCGTCCATTACAAGCTGAC
>probe:Drosophila_2:1633425_at:80:381; Interrogation_Position=1853; Antisense; GAACCCCACCAGTTGAACCTAGAGA

Paste this into a BLAST search page for me
TTACCGGAATCTACTGCATCTTGGGGAGAACTTCAACTCCATTCTGCAAGGAATGCTGGTTCCAAAATCCCATGGAGGGCCGCTTTAGTTGGAGTTCTCGGAGTTCTCGCTAGCATTGCCTGTATTGCCTGTATGGCCACCATTGTGATTGGGCCGCAATCACTATGACACTCTGAAGGAATTCAGCATCCTGGACCTCTTCTCCTTTAACTGGTACACGGTCACGGTATTCCGCTGAGTTACATCCTGAACATCCTGAAGTCTGGGCCTGATTAGCCTGATTACAAACCGAACCCGAAGAGCCGTTCGTCCATTACAAGCTGACGAACCCCACCAGTTGAACCTAGAGA

Full Affymetrix probeset data:

Annotations for 1633425_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720