FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633426_at:

>probe:Drosophila_2:1633426_at:44:521; Interrogation_Position=1045; Antisense; GTGGCTCTGTTTGGGCGACCTTTCG
>probe:Drosophila_2:1633426_at:363:293; Interrogation_Position=1060; Antisense; CGACCTTTCGATGGCTTAATAATAA
>probe:Drosophila_2:1633426_at:124:385; Interrogation_Position=1106; Antisense; GAACTTCTTCAAAAGCGTCTCGGGC
>probe:Drosophila_2:1633426_at:247:121; Interrogation_Position=1119; Antisense; AGCGTCTCGGGCAGGATTTGCAAAA
>probe:Drosophila_2:1633426_at:508:453; Interrogation_Position=1148; Antisense; GATCAAGTTCGGCTCACTCGAATTT
>probe:Drosophila_2:1633426_at:559:165; Interrogation_Position=761; Antisense; AAATGCCCAAATGTTTCTTGCCCTC
>probe:Drosophila_2:1633426_at:419:289; Interrogation_Position=785; Antisense; CGGTCTGTTCTGCTTGGGTTATAAA
>probe:Drosophila_2:1633426_at:436:663; Interrogation_Position=806; Antisense; TAAATCAATCCGTCCATGCATCCAT
>probe:Drosophila_2:1633426_at:691:33; Interrogation_Position=829; Antisense; ATCGATTCTTTCACGCCGGAATTTA
>probe:Drosophila_2:1633426_at:654:561; Interrogation_Position=846; Antisense; GGAATTTATGGTCTTCGCGCCCATA
>probe:Drosophila_2:1633426_at:453:181; Interrogation_Position=901; Antisense; AAAACACACAGTATCTCGGGCGACC
>probe:Drosophila_2:1633426_at:69:293; Interrogation_Position=921; Antisense; CGACCCCAACGAATTCTATCTTGTT
>probe:Drosophila_2:1633426_at:66:37; Interrogation_Position=938; Antisense; ATCTTGTTATCCCATTAACTGCGAA
>probe:Drosophila_2:1633426_at:405:461; Interrogation_Position=965; Antisense; GATTTATTTGTCTGCGTGTCTGATT

Paste this into a BLAST search page for me
GTGGCTCTGTTTGGGCGACCTTTCGCGACCTTTCGATGGCTTAATAATAAGAACTTCTTCAAAAGCGTCTCGGGCAGCGTCTCGGGCAGGATTTGCAAAAGATCAAGTTCGGCTCACTCGAATTTAAATGCCCAAATGTTTCTTGCCCTCCGGTCTGTTCTGCTTGGGTTATAAATAAATCAATCCGTCCATGCATCCATATCGATTCTTTCACGCCGGAATTTAGGAATTTATGGTCTTCGCGCCCATAAAAACACACAGTATCTCGGGCGACCCGACCCCAACGAATTCTATCTTGTTATCTTGTTATCCCATTAACTGCGAAGATTTATTTGTCTGCGTGTCTGATT

Full Affymetrix probeset data:

Annotations for 1633426_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720