Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633427_at:

>probe:Drosophila_2:1633427_at:265:255; Interrogation_Position=1024; Antisense; CAAAGCGTCTAGAGTATTGCCATTT
>probe:Drosophila_2:1633427_at:555:271; Interrogation_Position=1044; Antisense; CATTTACGTGTGTTGGTTTCCCCAT
>probe:Drosophila_2:1633427_at:322:271; Interrogation_Position=1066; Antisense; CATCCCAGTAGCTTAGTGCAACCAA
>probe:Drosophila_2:1633427_at:123:257; Interrogation_Position=1088; Antisense; CAAATATTTGTTCCCTTTCTGATGG
>probe:Drosophila_2:1633427_at:176:309; Interrogation_Position=623; Antisense; CCAGTTGTTTACTTCGTGCACACGA
>probe:Drosophila_2:1633427_at:14:429; Interrogation_Position=656; Antisense; GAGATTCTCATCATCGGAGTGCCCA
>probe:Drosophila_2:1633427_at:696:601; Interrogation_Position=686; Antisense; TGTTTCCTGATCACCACAATGCTGT
>probe:Drosophila_2:1633427_at:398:161; Interrogation_Position=701; Antisense; ACAATGCTGTGGAGATCGCTGGCCC
>probe:Drosophila_2:1633427_at:283:315; Interrogation_Position=764; Antisense; GCCATCGGAGCCATTCTGTTTGTGA
>probe:Drosophila_2:1633427_at:440:43; Interrogation_Position=803; Antisense; ATCGCGGTCACCATGTTCGTGGGCG
>probe:Drosophila_2:1633427_at:670:261; Interrogation_Position=923; Antisense; CAGCGCTCCCTTCGCAAGAAAATTA
>probe:Drosophila_2:1633427_at:135:709; Interrogation_Position=945; Antisense; TTAAGTGAAGCCAGTGCCCAGTGCT
>probe:Drosophila_2:1633427_at:716:85; Interrogation_Position=964; Antisense; AGTGCTCATCTGTCGGAGGCCCAGA
>probe:Drosophila_2:1633427_at:41:377; Interrogation_Position=997; Antisense; GAACGCAACCACCAAACTTAGTACT

Paste this into a BLAST search page for me
CAAAGCGTCTAGAGTATTGCCATTTCATTTACGTGTGTTGGTTTCCCCATCATCCCAGTAGCTTAGTGCAACCAACAAATATTTGTTCCCTTTCTGATGGCCAGTTGTTTACTTCGTGCACACGAGAGATTCTCATCATCGGAGTGCCCATGTTTCCTGATCACCACAATGCTGTACAATGCTGTGGAGATCGCTGGCCCGCCATCGGAGCCATTCTGTTTGTGAATCGCGGTCACCATGTTCGTGGGCGCAGCGCTCCCTTCGCAAGAAAATTATTAAGTGAAGCCAGTGCCCAGTGCTAGTGCTCATCTGTCGGAGGCCCAGAGAACGCAACCACCAAACTTAGTACT

Full Affymetrix probeset data:

Annotations for 1633427_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime