Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633428_at:

>probe:Drosophila_2:1633428_at:76:161; Interrogation_Position=4976; Antisense; AAAGAAGTTCCACACCAAGGCCCTG
>probe:Drosophila_2:1633428_at:214:419; Interrogation_Position=5001; Antisense; GAGCTGCACGCTCCCAAAGGAGTAG
>probe:Drosophila_2:1633428_at:685:223; Interrogation_Position=5017; Antisense; AAGGAGTAGAGATCACACCCGACAC
>probe:Drosophila_2:1633428_at:248:669; Interrogation_Position=5077; Antisense; TACGGCGTGCTCCTGATAGCTACGT
>probe:Drosophila_2:1633428_at:533:669; Interrogation_Position=5097; Antisense; TACGTCACCGTCACCAAGTCAGTGA
>probe:Drosophila_2:1633428_at:465:183; Interrogation_Position=5163; Antisense; AAGAACTTCCAGTCGACCTATTACA
>probe:Drosophila_2:1633428_at:440:687; Interrogation_Position=5208; Antisense; TATTTCACCTTCTCTTGCAACATTG
>probe:Drosophila_2:1633428_at:480:721; Interrogation_Position=5222; Antisense; TTGCAACATTGTCTACGGCGCCAAT
>probe:Drosophila_2:1633428_at:439:371; Interrogation_Position=5248; Antisense; GAAGGAGCAAGATCTGCCGTCCCAA
>probe:Drosophila_2:1633428_at:301:261; Interrogation_Position=5326; Antisense; CACCACCACACCCATATTATAGTAG
>probe:Drosophila_2:1633428_at:184:115; Interrogation_Position=5381; Antisense; AGCTTAACCAACTGCCATCTACAAA
>probe:Drosophila_2:1633428_at:146:693; Interrogation_Position=5420; Antisense; TTTGATGCAGCTTGCTCTTGAGCAC
>probe:Drosophila_2:1633428_at:179:113; Interrogation_Position=5440; Antisense; AGCACTTAAGTGTTTTTTCGCATAC
>probe:Drosophila_2:1633428_at:239:663; Interrogation_Position=5468; Antisense; TAAACGGTTTCACTGCCAATTCTTG

Paste this into a BLAST search page for me
AAAGAAGTTCCACACCAAGGCCCTGGAGCTGCACGCTCCCAAAGGAGTAGAAGGAGTAGAGATCACACCCGACACTACGGCGTGCTCCTGATAGCTACGTTACGTCACCGTCACCAAGTCAGTGAAAGAACTTCCAGTCGACCTATTACATATTTCACCTTCTCTTGCAACATTGTTGCAACATTGTCTACGGCGCCAATGAAGGAGCAAGATCTGCCGTCCCAACACCACCACACCCATATTATAGTAGAGCTTAACCAACTGCCATCTACAAATTTGATGCAGCTTGCTCTTGAGCACAGCACTTAAGTGTTTTTTCGCATACTAAACGGTTTCACTGCCAATTCTTG

Full Affymetrix probeset data:

Annotations for 1633428_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime