Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633429_at:

>probe:Drosophila_2:1633429_at:520:263; Interrogation_Position=2443; Antisense; CAGAATGTCATTTGCGTTACGTCCA
>probe:Drosophila_2:1633429_at:85:329; Interrogation_Position=2456; Antisense; GCGTTACGTCCAAGACCATTCAAGA
>probe:Drosophila_2:1633429_at:687:119; Interrogation_Position=2513; Antisense; AGCTGACCATCGACACCGATTACCT
>probe:Drosophila_2:1633429_at:717:461; Interrogation_Position=2530; Antisense; GATTACCTCGTCTGGAGTCCGCAAA
>probe:Drosophila_2:1633429_at:697:431; Interrogation_Position=2544; Antisense; GAGTCCGCAAACTGCAGCGGCAGTG
>probe:Drosophila_2:1633429_at:511:347; Interrogation_Position=2563; Antisense; GCAGTGGTCAGAGCTCCGGGAAATT
>probe:Drosophila_2:1633429_at:85:337; Interrogation_Position=2575; Antisense; GCTCCGGGAAATTCCGGCTAGCATA
>probe:Drosophila_2:1633429_at:707:337; Interrogation_Position=2591; Antisense; GCTAGCATACGGAACCTGGAGACCC
>probe:Drosophila_2:1633429_at:563:587; Interrogation_Position=2607; Antisense; TGGAGACCCCGTTCTGCTATCATCG
>probe:Drosophila_2:1633429_at:94:241; Interrogation_Position=2699; Antisense; AATAAGCTATTCTATTGCACCCCTC
>probe:Drosophila_2:1633429_at:184:717; Interrogation_Position=2713; Antisense; TTGCACCCCTCCAAACGAAAAATGT
>probe:Drosophila_2:1633429_at:303:141; Interrogation_Position=2830; Antisense; ACGGATAGGCTGTTGTAACTCTTAA
>probe:Drosophila_2:1633429_at:507:167; Interrogation_Position=2865; Antisense; AAATGTCTAATTCGTTTGGCTAATG
>probe:Drosophila_2:1633429_at:92:701; Interrogation_Position=2970; Antisense; TTATCTCGAAAAACTCTGGACTTGT

Paste this into a BLAST search page for me
CAGAATGTCATTTGCGTTACGTCCAGCGTTACGTCCAAGACCATTCAAGAAGCTGACCATCGACACCGATTACCTGATTACCTCGTCTGGAGTCCGCAAAGAGTCCGCAAACTGCAGCGGCAGTGGCAGTGGTCAGAGCTCCGGGAAATTGCTCCGGGAAATTCCGGCTAGCATAGCTAGCATACGGAACCTGGAGACCCTGGAGACCCCGTTCTGCTATCATCGAATAAGCTATTCTATTGCACCCCTCTTGCACCCCTCCAAACGAAAAATGTACGGATAGGCTGTTGTAACTCTTAAAAATGTCTAATTCGTTTGGCTAATGTTATCTCGAAAAACTCTGGACTTGT

Full Affymetrix probeset data:

Annotations for 1633429_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime