FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633430_at:

>probe:Drosophila_2:1633430_at:36:331; Interrogation_Position=1184; Antisense; GCGGCAACCGATGGAAGTTCTGCTA
>probe:Drosophila_2:1633430_at:649:93; Interrogation_Position=1199; Antisense; AGTTCTGCTAACTCCCAAAATTGTT
>probe:Drosophila_2:1633430_at:582:33; Interrogation_Position=1235; Antisense; ATCAATCCCAAATGAGCACACACCA
>probe:Drosophila_2:1633430_at:283:127; Interrogation_Position=1256; Antisense; ACCACACATCCTTCATATTCTTAAA
>probe:Drosophila_2:1633430_at:114:399; Interrogation_Position=1295; Antisense; GACACGACACGCGAGAAAACATTTT
>probe:Drosophila_2:1633430_at:407:179; Interrogation_Position=1311; Antisense; AAACATTTTGTATCTGCTGCCCAAC
>probe:Drosophila_2:1633430_at:714:193; Interrogation_Position=1333; Antisense; AACTGCGGAGGCGTTTACTCTGACC
>probe:Drosophila_2:1633430_at:76:643; Interrogation_Position=1351; Antisense; TCTGACCACCTAAACCTTAAACGAG
>probe:Drosophila_2:1633430_at:367:197; Interrogation_Position=1412; Antisense; AACGGAGACGTCTTGTTGCCGCAAT
>probe:Drosophila_2:1633430_at:153:699; Interrogation_Position=1424; Antisense; TTGTTGCCGCAATCAGTTTTTTAAA
>probe:Drosophila_2:1633430_at:574:533; Interrogation_Position=1455; Antisense; GGTGATAACGACCACGCTGCTGATA
>probe:Drosophila_2:1633430_at:415:297; Interrogation_Position=1469; Antisense; CGCTGCTGATAACTCGCCGATAACA
>probe:Drosophila_2:1633430_at:241:411; Interrogation_Position=1582; Antisense; GACGCCATATTGTGTATGTATTCTC
>probe:Drosophila_2:1633430_at:682:559; Interrogation_Position=1691; Antisense; GGAACGGGCCAGATCGGACAACTAT

Paste this into a BLAST search page for me
GCGGCAACCGATGGAAGTTCTGCTAAGTTCTGCTAACTCCCAAAATTGTTATCAATCCCAAATGAGCACACACCAACCACACATCCTTCATATTCTTAAAGACACGACACGCGAGAAAACATTTTAAACATTTTGTATCTGCTGCCCAACAACTGCGGAGGCGTTTACTCTGACCTCTGACCACCTAAACCTTAAACGAGAACGGAGACGTCTTGTTGCCGCAATTTGTTGCCGCAATCAGTTTTTTAAAGGTGATAACGACCACGCTGCTGATACGCTGCTGATAACTCGCCGATAACAGACGCCATATTGTGTATGTATTCTCGGAACGGGCCAGATCGGACAACTAT

Full Affymetrix probeset data:

Annotations for 1633430_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720