FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633432_at:

>probe:Drosophila_2:1633432_at:579:1; Interrogation_Position=1475; Antisense; ATTTACCGCCGGAGTTATGTTGCCA
>probe:Drosophila_2:1633432_at:161:115; Interrogation_Position=1517; Antisense; AGCTTTGCTCGGAGGATTCAGTTCA
>probe:Drosophila_2:1633432_at:359:473; Interrogation_Position=1537; Antisense; GTTCACTTATTGTTATGGCCTGGAT
>probe:Drosophila_2:1633432_at:703:495; Interrogation_Position=1587; Antisense; GTCACCGGTGATCTCGTCTATAAGA
>probe:Drosophila_2:1633432_at:594:27; Interrogation_Position=1642; Antisense; ATACGTTTGCCGGAGAACCACGCGA
>probe:Drosophila_2:1633432_at:692:99; Interrogation_Position=1685; Antisense; AGATGGTGCCATCAGTTCCGTTCCA
>probe:Drosophila_2:1633432_at:511:715; Interrogation_Position=1719; Antisense; TTCCAGCTGTATCGCATATCGTATC
>probe:Drosophila_2:1633432_at:425:483; Interrogation_Position=1739; Antisense; GTATCTCTATTTCACGCTTTTTGGA
>probe:Drosophila_2:1633432_at:483:699; Interrogation_Position=1756; Antisense; TTTTTGGAGCCCTGGTGACGATTGT
>probe:Drosophila_2:1633432_at:665:485; Interrogation_Position=1779; Antisense; GTAGTGGCACTGGTCACAAGTCTCC
>probe:Drosophila_2:1633432_at:436:439; Interrogation_Position=1824; Antisense; GATGGAGTTGACACACGTCTGCTCA
>probe:Drosophila_2:1633432_at:164:91; Interrogation_Position=1984; Antisense; AGTAGAAGGCTGACCGGCATCATCC
>probe:Drosophila_2:1633432_at:415:345; Interrogation_Position=2000; Antisense; GCATCATCCTGGCAAAGTTCCTTTC
>probe:Drosophila_2:1633432_at:143:95; Interrogation_Position=2015; Antisense; AGTTCCTTTCGGTAGCTTAGCAAAT

Paste this into a BLAST search page for me
ATTTACCGCCGGAGTTATGTTGCCAAGCTTTGCTCGGAGGATTCAGTTCAGTTCACTTATTGTTATGGCCTGGATGTCACCGGTGATCTCGTCTATAAGAATACGTTTGCCGGAGAACCACGCGAAGATGGTGCCATCAGTTCCGTTCCATTCCAGCTGTATCGCATATCGTATCGTATCTCTATTTCACGCTTTTTGGATTTTTGGAGCCCTGGTGACGATTGTGTAGTGGCACTGGTCACAAGTCTCCGATGGAGTTGACACACGTCTGCTCAAGTAGAAGGCTGACCGGCATCATCCGCATCATCCTGGCAAAGTTCCTTTCAGTTCCTTTCGGTAGCTTAGCAAAT

Full Affymetrix probeset data:

Annotations for 1633432_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720