FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633433_at:

>probe:Drosophila_2:1633433_at:640:241; Interrogation_Position=1957; Antisense; AATAGCCGGTTTATGCTCACTGTGC
>probe:Drosophila_2:1633433_at:201:597; Interrogation_Position=1977; Antisense; TGTGCTCAAACTATTCGACTACCGC
>probe:Drosophila_2:1633433_at:105:405; Interrogation_Position=1993; Antisense; GACTACCGCCTGCTGAAACAGTTTG
>probe:Drosophila_2:1633433_at:343:93; Interrogation_Position=2018; Antisense; AGTTCAAGATTCTGGTGGCGTCCGC
>probe:Drosophila_2:1633433_at:263:19; Interrogation_Position=2066; Antisense; ATATACCCTTTGTTTACTCGTCTGC
>probe:Drosophila_2:1633433_at:689:451; Interrogation_Position=2124; Antisense; GATCGGCCCCATTATCGGAATTAGT
>probe:Drosophila_2:1633433_at:38:57; Interrogation_Position=2158; Antisense; ATGAGAAACATCCTTGGCATCCTCG
>probe:Drosophila_2:1633433_at:300:695; Interrogation_Position=2243; Antisense; TTTCCGTTTTGATTAGCGCCTTCTA
>probe:Drosophila_2:1633433_at:678:483; Interrogation_Position=2298; Antisense; GTATGGCTTCTCCTATGCTGTAGCG
>probe:Drosophila_2:1633433_at:71:125; Interrogation_Position=2319; Antisense; AGCGCCTGGTGCGTACATTTACTTA
>probe:Drosophila_2:1633433_at:152:93; Interrogation_Position=2353; Antisense; AGTTTACAATATTACCCTCTCTCAT
>probe:Drosophila_2:1633433_at:386:27; Interrogation_Position=2387; Antisense; ATAGCTGTTTATTCCACACTGAGAG
>probe:Drosophila_2:1633433_at:711:529; Interrogation_Position=2462; Antisense; GGGATTACCTCATTGGCCATGGGAA
>probe:Drosophila_2:1633433_at:667:521; Interrogation_Position=2488; Antisense; GGGCGCCTTTATTGGGACTACAATT

Paste this into a BLAST search page for me
AATAGCCGGTTTATGCTCACTGTGCTGTGCTCAAACTATTCGACTACCGCGACTACCGCCTGCTGAAACAGTTTGAGTTCAAGATTCTGGTGGCGTCCGCATATACCCTTTGTTTACTCGTCTGCGATCGGCCCCATTATCGGAATTAGTATGAGAAACATCCTTGGCATCCTCGTTTCCGTTTTGATTAGCGCCTTCTAGTATGGCTTCTCCTATGCTGTAGCGAGCGCCTGGTGCGTACATTTACTTAAGTTTACAATATTACCCTCTCTCATATAGCTGTTTATTCCACACTGAGAGGGGATTACCTCATTGGCCATGGGAAGGGCGCCTTTATTGGGACTACAATT

Full Affymetrix probeset data:

Annotations for 1633433_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720