Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633435_a_at:

>probe:Drosophila_2:1633435_a_at:319:35; Interrogation_Position=1025; Antisense; ATCACCACGGCCATGCTAGTAGTAA
>probe:Drosophila_2:1633435_a_at:19:49; Interrogation_Position=1037; Antisense; ATGCTAGTAGTAACTGCCGCCGTTC
>probe:Drosophila_2:1633435_a_at:31:293; Interrogation_Position=1057; Antisense; CGTTCTTTATTTGGGTCTTCTGGCA
>probe:Drosophila_2:1633435_a_at:166:33; Interrogation_Position=1121; Antisense; ATAATCTTCTATGCGCTTTTTCTGA
>probe:Drosophila_2:1633435_a_at:32:343; Interrogation_Position=1135; Antisense; GCTTTTTCTGATTATCGCCTGTACA
>probe:Drosophila_2:1633435_a_at:132:111; Interrogation_Position=667; Antisense; AGAATTGATGCTTGCCTGCACTGTT
>probe:Drosophila_2:1633435_a_at:305:447; Interrogation_Position=702; Antisense; GATCCATCTTCTTCCTTTCAATGAT
>probe:Drosophila_2:1633435_a_at:80:231; Interrogation_Position=721; Antisense; AATGATTTCGGCCATCCTTTGGATT
>probe:Drosophila_2:1633435_a_at:587:457; Interrogation_Position=751; Antisense; GATATCCTATCTTCTTACGTGGTTT
>probe:Drosophila_2:1633435_a_at:345:103; Interrogation_Position=808; Antisense; AGACGCGATCATGGGCCTTACTGTA
>probe:Drosophila_2:1633435_a_at:296:565; Interrogation_Position=842; Antisense; GGCACTAGTGTTCCAGAAGTCGCGT
>probe:Drosophila_2:1633435_a_at:729:297; Interrogation_Position=862; Antisense; CGCGTCCTCGTATATTGTGTCCAAA
>probe:Drosophila_2:1633435_a_at:458:15; Interrogation_Position=941; Antisense; ATTTTAGTATGCCTTGGTCTACCCT
>probe:Drosophila_2:1633435_a_at:421:537; Interrogation_Position=956; Antisense; GGTCTACCCTGGCTTCTGAAAATTC

Paste this into a BLAST search page for me
ATCACCACGGCCATGCTAGTAGTAAATGCTAGTAGTAACTGCCGCCGTTCCGTTCTTTATTTGGGTCTTCTGGCAATAATCTTCTATGCGCTTTTTCTGAGCTTTTTCTGATTATCGCCTGTACAAGAATTGATGCTTGCCTGCACTGTTGATCCATCTTCTTCCTTTCAATGATAATGATTTCGGCCATCCTTTGGATTGATATCCTATCTTCTTACGTGGTTTAGACGCGATCATGGGCCTTACTGTAGGCACTAGTGTTCCAGAAGTCGCGTCGCGTCCTCGTATATTGTGTCCAAAATTTTAGTATGCCTTGGTCTACCCTGGTCTACCCTGGCTTCTGAAAATTC

Full Affymetrix probeset data:

Annotations for 1633435_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime