FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633436_at:

>probe:Drosophila_2:1633436_at:231:215; Interrogation_Position=1040; Antisense; AAGAGGTGCTTACGTAAATATTCAA
>probe:Drosophila_2:1633436_at:74:507; Interrogation_Position=465; Antisense; GTGCCAGCGATACCAGCACACTCAG
>probe:Drosophila_2:1633436_at:71:313; Interrogation_Position=496; Antisense; GCCACGATCCAATCTCGTCGAGGAG
>probe:Drosophila_2:1633436_at:95:637; Interrogation_Position=510; Antisense; TCGTCGAGGAGGAATATCAGCCTGT
>probe:Drosophila_2:1633436_at:575:519; Interrogation_Position=533; Antisense; GTGGAGATCTACAAATCCGACGATT
>probe:Drosophila_2:1633436_at:425:105; Interrogation_Position=553; Antisense; CGATTACTTCGGAAAGTCGGAGGAG
>probe:Drosophila_2:1633436_at:712:549; Interrogation_Position=577; Antisense; GGAGAACTACGTAGCTAAATGACTA
>probe:Drosophila_2:1633436_at:67:421; Interrogation_Position=621; Antisense; GATGAAACCTAGTTTTACTAAGCTT
>probe:Drosophila_2:1633436_at:658:105; Interrogation_Position=663; Antisense; AGAAGTTAGAGGATCTTTGCAGATG
>probe:Drosophila_2:1633436_at:37:107; Interrogation_Position=804; Antisense; AGACATCTAAATTCAGCTTCGTAAT
>probe:Drosophila_2:1633436_at:413:493; Interrogation_Position=824; Antisense; GTAATTACATTTAAGCACCTACTTG
>probe:Drosophila_2:1633436_at:74:355; Interrogation_Position=838; Antisense; GCACCTACTTGTTATAATTGTCATT
>probe:Drosophila_2:1633436_at:415:5; Interrogation_Position=924; Antisense; ATTGTTACATTAAGTCTGGCTGTTT
>probe:Drosophila_2:1633436_at:253:351; Interrogation_Position=994; Antisense; GCAGTTAGCTACGTGGATGCCATAA

Paste this into a BLAST search page for me
AAGAGGTGCTTACGTAAATATTCAAGTGCCAGCGATACCAGCACACTCAGGCCACGATCCAATCTCGTCGAGGAGTCGTCGAGGAGGAATATCAGCCTGTGTGGAGATCTACAAATCCGACGATTCGATTACTTCGGAAAGTCGGAGGAGGGAGAACTACGTAGCTAAATGACTAGATGAAACCTAGTTTTACTAAGCTTAGAAGTTAGAGGATCTTTGCAGATGAGACATCTAAATTCAGCTTCGTAATGTAATTACATTTAAGCACCTACTTGGCACCTACTTGTTATAATTGTCATTATTGTTACATTAAGTCTGGCTGTTTGCAGTTAGCTACGTGGATGCCATAA

Full Affymetrix probeset data:

Annotations for 1633436_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720