FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633439_at:

>probe:Drosophila_2:1633439_at:340:11; Interrogation_Position=1220; Antisense; ATTCGGGCCGGCAAGCACATTGTGG
>probe:Drosophila_2:1633439_at:720:591; Interrogation_Position=1240; Antisense; TGTGGACTACTTTCCCGAATACGAG
>probe:Drosophila_2:1633439_at:648:669; Interrogation_Position=1259; Antisense; TACGAGGACTTCTGCAAGAGGCCGC
>probe:Drosophila_2:1633439_at:568:439; Interrogation_Position=1276; Antisense; GAGGCCGCAGCAGGACAATTGCTTT
>probe:Drosophila_2:1633439_at:336:685; Interrogation_Position=1348; Antisense; TATCACACAGGAGCCGTTCAAGCGA
>probe:Drosophila_2:1633439_at:1:653; Interrogation_Position=1365; Antisense; TCAAGCGACACTCACGGAATCAGGT
>probe:Drosophila_2:1633439_at:83:447; Interrogation_Position=1449; Antisense; GATGCATCCGTGATGTCTTCTGCGA
>probe:Drosophila_2:1633439_at:729:441; Interrogation_Position=1472; Antisense; GATGTCCAGAAGATGATCCTCTCGG
>probe:Drosophila_2:1633439_at:360:115; Interrogation_Position=1508; Antisense; AGCATGGGCCTATTCTAGTCCAGAT
>probe:Drosophila_2:1633439_at:436:293; Interrogation_Position=1535; Antisense; CGTTGCGGATCGGAGAGCTTCTCAA
>probe:Drosophila_2:1633439_at:557:211; Interrogation_Position=1637; Antisense; AAGACCGTAGATCGTAGTGGCAACC
>probe:Drosophila_2:1633439_at:14:357; Interrogation_Position=1669; Antisense; GCACAATGGCTGGTACAACGCTTTA
>probe:Drosophila_2:1633439_at:240:211; Interrogation_Position=1722; Antisense; AAGAATCCTCATACCGAATGCTCTC
>probe:Drosophila_2:1633439_at:214:147; Interrogation_Position=1747; Antisense; ACTACTCCTTCAACCAATGTCTAAA

Paste this into a BLAST search page for me
ATTCGGGCCGGCAAGCACATTGTGGTGTGGACTACTTTCCCGAATACGAGTACGAGGACTTCTGCAAGAGGCCGCGAGGCCGCAGCAGGACAATTGCTTTTATCACACAGGAGCCGTTCAAGCGATCAAGCGACACTCACGGAATCAGGTGATGCATCCGTGATGTCTTCTGCGAGATGTCCAGAAGATGATCCTCTCGGAGCATGGGCCTATTCTAGTCCAGATCGTTGCGGATCGGAGAGCTTCTCAAAAGACCGTAGATCGTAGTGGCAACCGCACAATGGCTGGTACAACGCTTTAAAGAATCCTCATACCGAATGCTCTCACTACTCCTTCAACCAATGTCTAAA

Full Affymetrix probeset data:

Annotations for 1633439_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720