FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633442_at:

>probe:Drosophila_2:1633442_at:253:437; Interrogation_Position=122; Antisense; GAGGAGGTTCTAGGCTGGACATCAA
>probe:Drosophila_2:1633442_at:587:155; Interrogation_Position=14; Antisense; ACAGCATGATTCGAATTTTGGTTTT
>probe:Drosophila_2:1633442_at:667:489; Interrogation_Position=154; Antisense; GTAACTATAGTACCACCCGAAGGCG
>probe:Drosophila_2:1633442_at:105:301; Interrogation_Position=169; Antisense; CCCGAAGGCGAACTCTCGTTTGGAT
>probe:Drosophila_2:1633442_at:266:297; Interrogation_Position=177; Antisense; CGAACTCTCGTTTGGATATGGCTTT
>probe:Drosophila_2:1633442_at:317:23; Interrogation_Position=192; Antisense; ATATGGCTTTCGTCCTGGATTCTAT
>probe:Drosophila_2:1633442_at:240:463; Interrogation_Position=209; Antisense; GATTCTATTGATTTAATCCGCATCT
>probe:Drosophila_2:1633442_at:278:467; Interrogation_Position=250; Antisense; GTTGAGGGCAGCTGGTTTCATGTAC
>probe:Drosophila_2:1633442_at:73:541; Interrogation_Position=263; Antisense; GGTTTCATGTACAGCGTAAACGCTT
>probe:Drosophila_2:1633442_at:592:667; Interrogation_Position=303; Antisense; TACTATTTACTCAATGCTACTACAA
>probe:Drosophila_2:1633442_at:715:461; Interrogation_Position=42; Antisense; GATTACATTCACTCTAATGACTGGT
>probe:Drosophila_2:1633442_at:247:655; Interrogation_Position=56; Antisense; TAATGACTGGTAGCGCTCTTTGTTC
>probe:Drosophila_2:1633442_at:625:123; Interrogation_Position=67; Antisense; AGCGCTCTTTGTTCTATCGAGCAAC
>probe:Drosophila_2:1633442_at:476:43; Interrogation_Position=82; Antisense; ATCGAGCAACTTATGCGGGTCTTTG

Paste this into a BLAST search page for me
GAGGAGGTTCTAGGCTGGACATCAAACAGCATGATTCGAATTTTGGTTTTGTAACTATAGTACCACCCGAAGGCGCCCGAAGGCGAACTCTCGTTTGGATCGAACTCTCGTTTGGATATGGCTTTATATGGCTTTCGTCCTGGATTCTATGATTCTATTGATTTAATCCGCATCTGTTGAGGGCAGCTGGTTTCATGTACGGTTTCATGTACAGCGTAAACGCTTTACTATTTACTCAATGCTACTACAAGATTACATTCACTCTAATGACTGGTTAATGACTGGTAGCGCTCTTTGTTCAGCGCTCTTTGTTCTATCGAGCAACATCGAGCAACTTATGCGGGTCTTTG

Full Affymetrix probeset data:

Annotations for 1633442_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720