FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633445_at:

>probe:Drosophila_2:1633445_at:501:145; Interrogation_Position=241; Antisense; ACTCCTGCTATTAAGACGACCACTT
>probe:Drosophila_2:1633445_at:437:149; Interrogation_Position=262; Antisense; ACTTATGGTGCTGCTCCTCTGTACA
>probe:Drosophila_2:1633445_at:549:599; Interrogation_Position=281; Antisense; TGTACACTCAGGCTACTCCCATTGT
>probe:Drosophila_2:1633445_at:327:5; Interrogation_Position=301; Antisense; ATTGTGTCCAAGACTCTGGTCCATG
>probe:Drosophila_2:1633445_at:568:629; Interrogation_Position=327; Antisense; TCCAGCTCCCGTTGTTGAGAAGACT
>probe:Drosophila_2:1633445_at:406:109; Interrogation_Position=344; Antisense; AGAAGACTGTGTACGCTGCTGCTCC
>probe:Drosophila_2:1633445_at:623:639; Interrogation_Position=378; Antisense; TCTGGCCAAGACTGTTTACTCCGCT
>probe:Drosophila_2:1633445_at:540:467; Interrogation_Position=412; Antisense; GTTGTGGCCAAGCACGTTTATTCCG
>probe:Drosophila_2:1633445_at:245:703; Interrogation_Position=429; Antisense; TTATTCCGCTCCAGCTCAGGTTTAT
>probe:Drosophila_2:1633445_at:10:575; Interrogation_Position=639; Antisense; GGCTGTGGCCAAGACTGTGTCCTAT
>probe:Drosophila_2:1633445_at:445:229; Interrogation_Position=685; Antisense; AATGTGAACCATGGACCAGCTGCCA
>probe:Drosophila_2:1633445_at:620:593; Interrogation_Position=737; Antisense; TGGGCGTCTCCAGCTATGGAAGCTC
>probe:Drosophila_2:1633445_at:401:61; Interrogation_Position=752; Antisense; ATGGAAGCTCCCAGACGGTTCACTA
>probe:Drosophila_2:1633445_at:297:433; Interrogation_Position=789; Antisense; GAGTGTGTCGCACATGAGCTTCGAT

Paste this into a BLAST search page for me
ACTCCTGCTATTAAGACGACCACTTACTTATGGTGCTGCTCCTCTGTACATGTACACTCAGGCTACTCCCATTGTATTGTGTCCAAGACTCTGGTCCATGTCCAGCTCCCGTTGTTGAGAAGACTAGAAGACTGTGTACGCTGCTGCTCCTCTGGCCAAGACTGTTTACTCCGCTGTTGTGGCCAAGCACGTTTATTCCGTTATTCCGCTCCAGCTCAGGTTTATGGCTGTGGCCAAGACTGTGTCCTATAATGTGAACCATGGACCAGCTGCCATGGGCGTCTCCAGCTATGGAAGCTCATGGAAGCTCCCAGACGGTTCACTAGAGTGTGTCGCACATGAGCTTCGAT

Full Affymetrix probeset data:

Annotations for 1633445_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720