Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633446_s_at:

>probe:Drosophila_2:1633446_s_at:475:271; Interrogation_Position=293; Antisense; CATCGGCGGCACGTGGAACTTAAAC
>probe:Drosophila_2:1633446_s_at:280:51; Interrogation_Position=334; Antisense; ATGCGGAAATCGTAGCCTCAGGCGT
>probe:Drosophila_2:1633446_s_at:309:123; Interrogation_Position=347; Antisense; AGCCTCAGGCGTCATGGTTGGATTC
>probe:Drosophila_2:1633446_s_at:173:461; Interrogation_Position=374; Antisense; GATTTACACTGGATGCCACACCATT
>probe:Drosophila_2:1633446_s_at:518:657; Interrogation_Position=425; Antisense; TAAGGGAGAGCTGTGCGACACCATC
>probe:Drosophila_2:1633446_s_at:239:37; Interrogation_Position=447; Antisense; ATCATGAACGTGGTTGGCTGCATCA
>probe:Drosophila_2:1633446_s_at:655:519; Interrogation_Position=492; Antisense; GTGGCACTCCACTACTGGAAGGGTT
>probe:Drosophila_2:1633446_s_at:561:267; Interrogation_Position=518; Antisense; CATGTCCGACGAGGGATTCCTGTAT
>probe:Drosophila_2:1633446_s_at:270:383; Interrogation_Position=545; Antisense; GAACTCGGAGCGTCAAGTGGGCATT
>probe:Drosophila_2:1633446_s_at:439:9; Interrogation_Position=567; Antisense; ATTGCCATGGGCTCGCTGTGCGTTA
>probe:Drosophila_2:1633446_s_at:80:587; Interrogation_Position=613; Antisense; TGGACACCGTGTTGGCTTGCATACA
>probe:Drosophila_2:1633446_s_at:191:687; Interrogation_Position=639; Antisense; TATTCGAAGGGCGACACCGACTACA
>probe:Drosophila_2:1633446_s_at:490:317; Interrogation_Position=703; Antisense; GCCGAATAAACACCATCCACATTTG
>probe:Drosophila_2:1633446_s_at:224:223; Interrogation_Position=798; Antisense; AAGGGTCAATTGTCGCTGTACTATA

Paste this into a BLAST search page for me
CATCGGCGGCACGTGGAACTTAAACATGCGGAAATCGTAGCCTCAGGCGTAGCCTCAGGCGTCATGGTTGGATTCGATTTACACTGGATGCCACACCATTTAAGGGAGAGCTGTGCGACACCATCATCATGAACGTGGTTGGCTGCATCAGTGGCACTCCACTACTGGAAGGGTTCATGTCCGACGAGGGATTCCTGTATGAACTCGGAGCGTCAAGTGGGCATTATTGCCATGGGCTCGCTGTGCGTTATGGACACCGTGTTGGCTTGCATACATATTCGAAGGGCGACACCGACTACAGCCGAATAAACACCATCCACATTTGAAGGGTCAATTGTCGCTGTACTATA

Full Affymetrix probeset data:

Annotations for 1633446_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime