FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633447_at:

>probe:Drosophila_2:1633447_at:128:229; Interrogation_Position=2280; Antisense; AATGTGCGCAGAACTCAAACTATTT
>probe:Drosophila_2:1633447_at:361:71; Interrogation_Position=2379; Antisense; AGGTAACCTCTCTCAAAGATCTATT
>probe:Drosophila_2:1633447_at:622:657; Interrogation_Position=2430; Antisense; TAACTACCAGATTCCTTTTTGCGCG
>probe:Drosophila_2:1633447_at:45:701; Interrogation_Position=2445; Antisense; TTTTTGCGCGAATCCAAATGCGATT
>probe:Drosophila_2:1633447_at:423:363; Interrogation_Position=2509; Antisense; GAATTTTGCAACTAGGCTTACTACT
>probe:Drosophila_2:1633447_at:296:585; Interrogation_Position=2537; Antisense; TGTGACTTAAACCACGGAAGCTCCG
>probe:Drosophila_2:1633447_at:412:563; Interrogation_Position=2552; Antisense; GGAAGCTCCGTACCGCACAGAAGTT
>probe:Drosophila_2:1633447_at:552:243; Interrogation_Position=2596; Antisense; AATTTACCACTCGATTGCACTCGAC
>probe:Drosophila_2:1633447_at:31:355; Interrogation_Position=2612; Antisense; GCACTCGACTCGTTTAAGGACGCTT
>probe:Drosophila_2:1633447_at:634:407; Interrogation_Position=2630; Antisense; GACGCTTTTTCATTATATACCTTTA
>probe:Drosophila_2:1633447_at:33:711; Interrogation_Position=2668; Antisense; TTAAGCCTTATCCTAACCAAATTGA
>probe:Drosophila_2:1633447_at:479:661; Interrogation_Position=2750; Antisense; TAACTTTGTCTAGGATAATCAGCTC
>probe:Drosophila_2:1633447_at:143:653; Interrogation_Position=2765; Antisense; TAATCAGCTCTTAAAAGGCCCCGGC
>probe:Drosophila_2:1633447_at:215:319; Interrogation_Position=2782; Antisense; GCCCCGGCCCAGCTATACAAATAAA

Paste this into a BLAST search page for me
AATGTGCGCAGAACTCAAACTATTTAGGTAACCTCTCTCAAAGATCTATTTAACTACCAGATTCCTTTTTGCGCGTTTTTGCGCGAATCCAAATGCGATTGAATTTTGCAACTAGGCTTACTACTTGTGACTTAAACCACGGAAGCTCCGGGAAGCTCCGTACCGCACAGAAGTTAATTTACCACTCGATTGCACTCGACGCACTCGACTCGTTTAAGGACGCTTGACGCTTTTTCATTATATACCTTTATTAAGCCTTATCCTAACCAAATTGATAACTTTGTCTAGGATAATCAGCTCTAATCAGCTCTTAAAAGGCCCCGGCGCCCCGGCCCAGCTATACAAATAAA

Full Affymetrix probeset data:

Annotations for 1633447_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720