FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633448_at:

>probe:Drosophila_2:1633448_at:27:355; Interrogation_Position=1327; Antisense; GCAGCCGTTCAATGCGAAACTCTAC
>probe:Drosophila_2:1633448_at:319:187; Interrogation_Position=1353; Antisense; AACAGGTTGTGGGAATCCCCGAGCT
>probe:Drosophila_2:1633448_at:89:419; Interrogation_Position=1373; Antisense; GAGCTGCGGCACTTTCTTTACAAGC
>probe:Drosophila_2:1633448_at:216:53; Interrogation_Position=1427; Antisense; ATGCTCAGGCATCCGTACAAATCTC
>probe:Drosophila_2:1633448_at:135:665; Interrogation_Position=1442; Antisense; TACAAATCTCTGACGGAGCTGGAGC
>probe:Drosophila_2:1633448_at:161:619; Interrogation_Position=1494; Antisense; TGCATCGCATCCACAACAGTAGTCG
>probe:Drosophila_2:1633448_at:532:591; Interrogation_Position=1568; Antisense; TGGGCAACCGGAACCTACGAACTGT
>probe:Drosophila_2:1633448_at:347:383; Interrogation_Position=1586; Antisense; GAACTGTACGCCATATTCGAGCCGG
>probe:Drosophila_2:1633448_at:13:707; Interrogation_Position=1601; Antisense; TTCGAGCCGGTTGTGGACAAAGCCA
>probe:Drosophila_2:1633448_at:253:137; Interrogation_Position=1690; Antisense; ACGAAACCATGCCACATTCTAAGCT
>probe:Drosophila_2:1633448_at:211:151; Interrogation_Position=1703; Antisense; ACATTCTAAGCTTTAGCGCGCTTCG
>probe:Drosophila_2:1633448_at:276:299; Interrogation_Position=1719; Antisense; CGCGCTTCGCTAGGGCATTGTGAGA
>probe:Drosophila_2:1633448_at:402:699; Interrogation_Position=1757; Antisense; TTTTATTGCTCCTCTGCCAATCGAA
>probe:Drosophila_2:1633448_at:610:605; Interrogation_Position=1810; Antisense; TGACGGCGTTTGTTTAACTGAACCT

Paste this into a BLAST search page for me
GCAGCCGTTCAATGCGAAACTCTACAACAGGTTGTGGGAATCCCCGAGCTGAGCTGCGGCACTTTCTTTACAAGCATGCTCAGGCATCCGTACAAATCTCTACAAATCTCTGACGGAGCTGGAGCTGCATCGCATCCACAACAGTAGTCGTGGGCAACCGGAACCTACGAACTGTGAACTGTACGCCATATTCGAGCCGGTTCGAGCCGGTTGTGGACAAAGCCAACGAAACCATGCCACATTCTAAGCTACATTCTAAGCTTTAGCGCGCTTCGCGCGCTTCGCTAGGGCATTGTGAGATTTTATTGCTCCTCTGCCAATCGAATGACGGCGTTTGTTTAACTGAACCT

Full Affymetrix probeset data:

Annotations for 1633448_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720