FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633450_at:

>probe:Drosophila_2:1633450_at:330:109; Interrogation_Position=1050; Antisense; AGAAGTTATATCTCCGTCGCTTAGG
>probe:Drosophila_2:1633450_at:159:503; Interrogation_Position=1065; Antisense; GTCGCTTAGGTCGTTGCATTTTGAA
>probe:Drosophila_2:1633450_at:524:617; Interrogation_Position=1079; Antisense; TGCATTTTGAACTACACCGATGAAA
>probe:Drosophila_2:1633450_at:279:443; Interrogation_Position=1111; Antisense; GATGATTGATCAGCATACCCAGGAC
>probe:Drosophila_2:1633450_at:548:57; Interrogation_Position=1173; Antisense; ATGATCGCCAGTTTGCCGGATTTAA
>probe:Drosophila_2:1633450_at:25:59; Interrogation_Position=1209; Antisense; ATGATAGCTTTAGCGTGCACACCAC
>probe:Drosophila_2:1633450_at:20:127; Interrogation_Position=1229; Antisense; ACCACGGACTCTGCGGTTGGTGACG
>probe:Drosophila_2:1633450_at:645:465; Interrogation_Position=1244; Antisense; GTTGGTGACGCGTCCAGCATTCAGA
>probe:Drosophila_2:1633450_at:22:629; Interrogation_Position=1256; Antisense; TCCAGCATTCAGATCGTAGTCCAAT
>probe:Drosophila_2:1633450_at:557:475; Interrogation_Position=1325; Antisense; GTTTTAACGACTTTGGCAACGAGCA
>probe:Drosophila_2:1633450_at:490:565; Interrogation_Position=1339; Antisense; GGCAACGAGCATGGCTAATCACTTT
>probe:Drosophila_2:1633450_at:684:167; Interrogation_Position=949; Antisense; AAATGTGTTCTTCGGTAGGCTGGAC
>probe:Drosophila_2:1633450_at:407:617; Interrogation_Position=981; Antisense; TGCAGCGCACCATACTCGGTGGTAT
>probe:Drosophila_2:1633450_at:583:281; Interrogation_Position=995; Antisense; CTCGGTGGTATTGCCTATATCGGAA

Paste this into a BLAST search page for me
AGAAGTTATATCTCCGTCGCTTAGGGTCGCTTAGGTCGTTGCATTTTGAATGCATTTTGAACTACACCGATGAAAGATGATTGATCAGCATACCCAGGACATGATCGCCAGTTTGCCGGATTTAAATGATAGCTTTAGCGTGCACACCACACCACGGACTCTGCGGTTGGTGACGGTTGGTGACGCGTCCAGCATTCAGATCCAGCATTCAGATCGTAGTCCAATGTTTTAACGACTTTGGCAACGAGCAGGCAACGAGCATGGCTAATCACTTTAAATGTGTTCTTCGGTAGGCTGGACTGCAGCGCACCATACTCGGTGGTATCTCGGTGGTATTGCCTATATCGGAA

Full Affymetrix probeset data:

Annotations for 1633450_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720