FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633451_at:

>probe:Drosophila_2:1633451_at:263:7; Interrogation_Position=386; Antisense; ATTGAGGCTGCTTCATGCTAATTCC
>probe:Drosophila_2:1633451_at:626:339; Interrogation_Position=402; Antisense; GCTAATTCCTTCAATCGCAGCAAGT
>probe:Drosophila_2:1633451_at:114:361; Interrogation_Position=421; Antisense; GCAAGTATGAAACCTTTGGCCGCCA
>probe:Drosophila_2:1633451_at:25:699; Interrogation_Position=544; Antisense; TTTTACCTTTTGTTCTTGCATCCTA
>probe:Drosophila_2:1633451_at:104:473; Interrogation_Position=555; Antisense; GTTCTTGCATCCTAACATCTACTGA
>probe:Drosophila_2:1633451_at:510:285; Interrogation_Position=576; Antisense; CTGAGATAATCTTGTTCGCGCTAAT
>probe:Drosophila_2:1633451_at:68:249; Interrogation_Position=598; Antisense; AATTGTCTGCTCTCTGTGTGTAATA
>probe:Drosophila_2:1633451_at:459:33; Interrogation_Position=666; Antisense; ATCAGCTCGAACTCACAGTCAGACA
>probe:Drosophila_2:1633451_at:543:647; Interrogation_Position=749; Antisense; TCAGGGCAGGGCAGAATCTTCTTCA
>probe:Drosophila_2:1633451_at:718:635; Interrogation_Position=777; Antisense; TCGCAACTTCACAGCGCGGATGGTA
>probe:Drosophila_2:1633451_at:495:605; Interrogation_Position=843; Antisense; TGATCCTCTCTTGCTGCTAACTGAT
>probe:Drosophila_2:1633451_at:173:195; Interrogation_Position=879; Antisense; AACTGCTTCTTCATACGACCTACGT
>probe:Drosophila_2:1633451_at:223:471; Interrogation_Position=902; Antisense; GTTCTTCGGCTGCTGCAACAGAATA
>probe:Drosophila_2:1633451_at:615:11; Interrogation_Position=932; Antisense; ATTCACCAATATATCCACCAACAAC

Paste this into a BLAST search page for me
ATTGAGGCTGCTTCATGCTAATTCCGCTAATTCCTTCAATCGCAGCAAGTGCAAGTATGAAACCTTTGGCCGCCATTTTACCTTTTGTTCTTGCATCCTAGTTCTTGCATCCTAACATCTACTGACTGAGATAATCTTGTTCGCGCTAATAATTGTCTGCTCTCTGTGTGTAATAATCAGCTCGAACTCACAGTCAGACATCAGGGCAGGGCAGAATCTTCTTCATCGCAACTTCACAGCGCGGATGGTATGATCCTCTCTTGCTGCTAACTGATAACTGCTTCTTCATACGACCTACGTGTTCTTCGGCTGCTGCAACAGAATAATTCACCAATATATCCACCAACAAC

Full Affymetrix probeset data:

Annotations for 1633451_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720