FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633455_at:

>probe:Drosophila_2:1633455_at:168:613; Interrogation_Position=1010; Antisense; TGAAAGGGCGCAGGCACAGGCTTAT
>probe:Drosophila_2:1633455_at:547:509; Interrogation_Position=1046; Antisense; GTGCATATTTGAGCGGGTGCCCAGT
>probe:Drosophila_2:1633455_at:207:93; Interrogation_Position=1068; Antisense; AGTTGGCATCCGCTGAAGACCAAAC
>probe:Drosophila_2:1633455_at:78:415; Interrogation_Position=1085; Antisense; GACCAAACAGTTTCACATCAGCTTC
>probe:Drosophila_2:1633455_at:567:711; Interrogation_Position=1165; Antisense; TTCAGCTATTCCTCTCCAAGATGGG
>probe:Drosophila_2:1633455_at:338:673; Interrogation_Position=1213; Antisense; TAGCCCAGCGGGTGAAGTGCATCAA
>probe:Drosophila_2:1633455_at:543:303; Interrogation_Position=1306; Antisense; CCGAGCGATCCGAGGAGCAGTTCTA
>probe:Drosophila_2:1633455_at:555:93; Interrogation_Position=1324; Antisense; AGTTCTACTGCGAGAATGCGCTGAA
>probe:Drosophila_2:1633455_at:463:51; Interrogation_Position=1339; Antisense; ATGCGCTGAAAAGCCTCCAGAGCAA
>probe:Drosophila_2:1633455_at:635:335; Interrogation_Position=842; Antisense; GCTCGGCAAGCTGCTTCGGGATCAA
>probe:Drosophila_2:1633455_at:521:527; Interrogation_Position=859; Antisense; GGGATCAACCCACTCCAGTGGAAGT
>probe:Drosophila_2:1633455_at:16:565; Interrogation_Position=878; Antisense; GGAAGTGCTCTATGCTTGCTGCCAG
>probe:Drosophila_2:1633455_at:10:545; Interrogation_Position=926; Antisense; GGATATGCTCAAACCAGTGTCACCT
>probe:Drosophila_2:1633455_at:602:23; Interrogation_Position=975; Antisense; ATATCGCCGGCCCAGTACGAGTGGA

Paste this into a BLAST search page for me
TGAAAGGGCGCAGGCACAGGCTTATGTGCATATTTGAGCGGGTGCCCAGTAGTTGGCATCCGCTGAAGACCAAACGACCAAACAGTTTCACATCAGCTTCTTCAGCTATTCCTCTCCAAGATGGGTAGCCCAGCGGGTGAAGTGCATCAACCGAGCGATCCGAGGAGCAGTTCTAAGTTCTACTGCGAGAATGCGCTGAAATGCGCTGAAAAGCCTCCAGAGCAAGCTCGGCAAGCTGCTTCGGGATCAAGGGATCAACCCACTCCAGTGGAAGTGGAAGTGCTCTATGCTTGCTGCCAGGGATATGCTCAAACCAGTGTCACCTATATCGCCGGCCCAGTACGAGTGGA

Full Affymetrix probeset data:

Annotations for 1633455_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720