FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633457_at:

>probe:Drosophila_2:1633457_at:501:541; Interrogation_Position=2448; Antisense; GGAGTCGTCCCAATCGGAGTCATTG
>probe:Drosophila_2:1633457_at:711:367; Interrogation_Position=2492; Antisense; GAATGCAATTCCTATCGCTCATTAA
>probe:Drosophila_2:1633457_at:699:501; Interrogation_Position=2623; Antisense; GTGCTCCAAAATGCGGAACTCCTTA
>probe:Drosophila_2:1633457_at:507:383; Interrogation_Position=2638; Antisense; GAACTCCTTAACAGTGTGTCTCCGG
>probe:Drosophila_2:1633457_at:190:597; Interrogation_Position=2652; Antisense; TGTGTCTCCGGTGCCAGAGCCTGAA
>probe:Drosophila_2:1633457_at:57:265; Interrogation_Position=2666; Antisense; CAGAGCCTGAATTATGTTCCATCAT
>probe:Drosophila_2:1633457_at:38:39; Interrogation_Position=2723; Antisense; ATCTAAAAGATCTGCGAGGTTCCTC
>probe:Drosophila_2:1633457_at:472:435; Interrogation_Position=2738; Antisense; GAGGTTCCTCGATTATTCAGCGTTC
>probe:Drosophila_2:1633457_at:405:121; Interrogation_Position=2756; Antisense; AGCGTTCGCCTTCAGCCGAAGAGGA
>probe:Drosophila_2:1633457_at:246:53; Interrogation_Position=2825; Antisense; ATGAATTCATCAACGTAGACCAGGA
>probe:Drosophila_2:1633457_at:242:527; Interrogation_Position=2903; Antisense; GGGAATCTGACGACTTAGAATCCAT
>probe:Drosophila_2:1633457_at:389:375; Interrogation_Position=2947; Antisense; GAAGAGCATACCGATATGGCCGAAG
>probe:Drosophila_2:1633457_at:450:319; Interrogation_Position=2965; Antisense; GCCGAAGAGGTCGTGGTTTACTCCA
>probe:Drosophila_2:1633457_at:544:477; Interrogation_Position=2980; Antisense; GTTTACTCCACCAAAGAATCGCAGG

Paste this into a BLAST search page for me
GGAGTCGTCCCAATCGGAGTCATTGGAATGCAATTCCTATCGCTCATTAAGTGCTCCAAAATGCGGAACTCCTTAGAACTCCTTAACAGTGTGTCTCCGGTGTGTCTCCGGTGCCAGAGCCTGAACAGAGCCTGAATTATGTTCCATCATATCTAAAAGATCTGCGAGGTTCCTCGAGGTTCCTCGATTATTCAGCGTTCAGCGTTCGCCTTCAGCCGAAGAGGAATGAATTCATCAACGTAGACCAGGAGGGAATCTGACGACTTAGAATCCATGAAGAGCATACCGATATGGCCGAAGGCCGAAGAGGTCGTGGTTTACTCCAGTTTACTCCACCAAAGAATCGCAGG

Full Affymetrix probeset data:

Annotations for 1633457_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720