FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633458_at:

>probe:Drosophila_2:1633458_at:160:271; Interrogation_Position=1469; Antisense; CATCGAGGTGATGGGCTTCAATATC
>probe:Drosophila_2:1633458_at:648:345; Interrogation_Position=1537; Antisense; GCATCAACGATAGTCAGACGCGTCT
>probe:Drosophila_2:1633458_at:718:639; Interrogation_Position=1559; Antisense; TCTGCTGGTCCACTCGATGTCGATG
>probe:Drosophila_2:1633458_at:657:61; Interrogation_Position=1581; Antisense; ATGTCGCATTTGGAGGCGCATGACC
>probe:Drosophila_2:1633458_at:204:439; Interrogation_Position=1593; Antisense; GAGGCGCATGACCACTTTAGGAGTA
>probe:Drosophila_2:1633458_at:16:399; Interrogation_Position=1625; Antisense; GACACTGGGCAGTCGGATGCTACGA
>probe:Drosophila_2:1633458_at:515:471; Interrogation_Position=1665; Antisense; GTTCGCTGCCGTAATGGTGATCCAT
>probe:Drosophila_2:1633458_at:448:725; Interrogation_Position=1689; Antisense; TTGAACCGCAGCAATGTCACATACA
>probe:Drosophila_2:1633458_at:640:159; Interrogation_Position=1711; Antisense; ACAAGGATGGTTTGCCTGCGATGCC
>probe:Drosophila_2:1633458_at:290:319; Interrogation_Position=1733; Antisense; GCCCGAGGAGGAGTTCGTTGACCAA
>probe:Drosophila_2:1633458_at:207:469; Interrogation_Position=1749; Antisense; GTTGACCAAAGGAACCAGCGCTAGT
>probe:Drosophila_2:1633458_at:63:685; Interrogation_Position=1821; Antisense; TATCCTGTTATTTTATGTCGCGTTA
>probe:Drosophila_2:1633458_at:626:327; Interrogation_Position=1840; Antisense; GCGTTATGTCGATTCAATTAGTCCA
>probe:Drosophila_2:1633458_at:435:49; Interrogation_Position=1873; Antisense; ATGCCATAGCATTCAGTTAACCAAT

Paste this into a BLAST search page for me
CATCGAGGTGATGGGCTTCAATATCGCATCAACGATAGTCAGACGCGTCTTCTGCTGGTCCACTCGATGTCGATGATGTCGCATTTGGAGGCGCATGACCGAGGCGCATGACCACTTTAGGAGTAGACACTGGGCAGTCGGATGCTACGAGTTCGCTGCCGTAATGGTGATCCATTTGAACCGCAGCAATGTCACATACAACAAGGATGGTTTGCCTGCGATGCCGCCCGAGGAGGAGTTCGTTGACCAAGTTGACCAAAGGAACCAGCGCTAGTTATCCTGTTATTTTATGTCGCGTTAGCGTTATGTCGATTCAATTAGTCCAATGCCATAGCATTCAGTTAACCAAT

Full Affymetrix probeset data:

Annotations for 1633458_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720