Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633460_at:

>probe:Drosophila_2:1633460_at:560:695; Interrogation_Position=1039; Antisense; TTTCATCGTGTGGATTGTCAACCGC
>probe:Drosophila_2:1633460_at:223:599; Interrogation_Position=1054; Antisense; TGTCAACCGCGTTTGTTACAGGGAT
>probe:Drosophila_2:1633460_at:713:81; Interrogation_Position=1073; Antisense; AGGGATGGATCATTGGTGCCCACTC
>probe:Drosophila_2:1633460_at:320:177; Interrogation_Position=1191; Antisense; AAACTTTTTGCGCTCTCAATGGCAA
>probe:Drosophila_2:1633460_at:570:225; Interrogation_Position=1208; Antisense; AATGGCAATCTAATCCGAACTTCCG
>probe:Drosophila_2:1633460_at:630:149; Interrogation_Position=1226; Antisense; ACTTCCGCGGCTCTTATAGTTACTA
>probe:Drosophila_2:1633460_at:683:671; Interrogation_Position=1242; Antisense; TAGTTACTACTCCACTTACGCTGAT
>probe:Drosophila_2:1633460_at:417:135; Interrogation_Position=1259; Antisense; ACGCTGATGAACTCCGTACGGGACG
>probe:Drosophila_2:1633460_at:172:141; Interrogation_Position=1276; Antisense; ACGGGACGCACGGATTTGGCATCAC
>probe:Drosophila_2:1633460_at:646:159; Interrogation_Position=1332; Antisense; ACAATTCGCCGGAGAGGCTTCGAGC
>probe:Drosophila_2:1633460_at:395:139; Interrogation_Position=1372; Antisense; ACGGTCCACGGAGCCATTGAGTCGG
>probe:Drosophila_2:1633460_at:544:313; Interrogation_Position=858; Antisense; GCCAGCCTCCAAGATCAGGTCGATA
>probe:Drosophila_2:1633460_at:71:553; Interrogation_Position=930; Antisense; GGAGCAGCCAGTGCCGGAAAACATT
>probe:Drosophila_2:1633460_at:638:105; Interrogation_Position=957; Antisense; AGAAATGGCGTTCCTTTGGCTTGAG

Paste this into a BLAST search page for me
TTTCATCGTGTGGATTGTCAACCGCTGTCAACCGCGTTTGTTACAGGGATAGGGATGGATCATTGGTGCCCACTCAAACTTTTTGCGCTCTCAATGGCAAAATGGCAATCTAATCCGAACTTCCGACTTCCGCGGCTCTTATAGTTACTATAGTTACTACTCCACTTACGCTGATACGCTGATGAACTCCGTACGGGACGACGGGACGCACGGATTTGGCATCACACAATTCGCCGGAGAGGCTTCGAGCACGGTCCACGGAGCCATTGAGTCGGGCCAGCCTCCAAGATCAGGTCGATAGGAGCAGCCAGTGCCGGAAAACATTAGAAATGGCGTTCCTTTGGCTTGAG

Full Affymetrix probeset data:

Annotations for 1633460_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime