FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633465_at:

>probe:Drosophila_2:1633465_at:470:627; Interrogation_Position=106; Antisense; TCCAGCTCAGGATCCGTGTACGGAA
>probe:Drosophila_2:1633465_at:411:623; Interrogation_Position=174; Antisense; TGCGGATCCCATCAGCGTGAGTCTG
>probe:Drosophila_2:1633465_at:508:93; Interrogation_Position=239; Antisense; AGTTGGCCTACGGATTTGCCCAGAA
>probe:Drosophila_2:1633465_at:18:221; Interrogation_Position=283; Antisense; AAGGTGGTGTTCTCCAACGTGCCCG
>probe:Drosophila_2:1633465_at:584:197; Interrogation_Position=298; Antisense; AACGTGCCCGAGGAGAATCTCTTCA
>probe:Drosophila_2:1633465_at:429:375; Interrogation_Position=348; Antisense; GAAGAAGCGCACCTATGCGACCAAG
>probe:Drosophila_2:1633465_at:73:421; Interrogation_Position=409; Antisense; GAGCAGGAACAGTCCTCCGATGATG
>probe:Drosophila_2:1633465_at:555:193; Interrogation_Position=446; Antisense; AACTCACCTACAAACAGCTGGGCTA
>probe:Drosophila_2:1633465_at:159:121; Interrogation_Position=461; Antisense; AGCTGGGCTACATCACCGAGCAATA
>probe:Drosophila_2:1633465_at:525:117; Interrogation_Position=520; Antisense; AGCTCCAGTTATGCGTACAAGGACT
>probe:Drosophila_2:1633465_at:454:461; Interrogation_Position=550; Antisense; GATTCCAGCGAGAGCGGCTACGGTA
>probe:Drosophila_2:1633465_at:111:515; Interrogation_Position=589; Antisense; GTGTCCGTGGACTGTGGCTTCAAGC
>probe:Drosophila_2:1633465_at:541:541; Interrogation_Position=620; Antisense; GGATCACCTCGTACCGGAAGTCAAA
>probe:Drosophila_2:1633465_at:544:541; Interrogation_Position=651; Antisense; GGAGTCCGACGACGGTTACTACTGA

Paste this into a BLAST search page for me
TCCAGCTCAGGATCCGTGTACGGAATGCGGATCCCATCAGCGTGAGTCTGAGTTGGCCTACGGATTTGCCCAGAAAAGGTGGTGTTCTCCAACGTGCCCGAACGTGCCCGAGGAGAATCTCTTCAGAAGAAGCGCACCTATGCGACCAAGGAGCAGGAACAGTCCTCCGATGATGAACTCACCTACAAACAGCTGGGCTAAGCTGGGCTACATCACCGAGCAATAAGCTCCAGTTATGCGTACAAGGACTGATTCCAGCGAGAGCGGCTACGGTAGTGTCCGTGGACTGTGGCTTCAAGCGGATCACCTCGTACCGGAAGTCAAAGGAGTCCGACGACGGTTACTACTGA

Full Affymetrix probeset data:

Annotations for 1633465_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720