FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633466_at:

>probe:Drosophila_2:1633466_at:712:219; Interrogation_Position=3081; Antisense; AAGTGCCTCGGTTCTATGCTCCTGT
>probe:Drosophila_2:1633466_at:373:621; Interrogation_Position=3117; Antisense; TGCTGCCGCTGGACCAGAAGAGCCA
>probe:Drosophila_2:1633466_at:247:347; Interrogation_Position=3150; Antisense; GCATGAAGACGCTCGGTCAACTCAA
>probe:Drosophila_2:1633466_at:101:185; Interrogation_Position=3192; Antisense; AAAATGCAGCCCAGCCCGACAGTAT
>probe:Drosophila_2:1633466_at:188:485; Interrogation_Position=3213; Antisense; GTATGTACACAACGATCGTGCGCAA
>probe:Drosophila_2:1633466_at:200:361; Interrogation_Position=3234; Antisense; GCAAGGAGAAAATTTTCCGCCCACT
>probe:Drosophila_2:1633466_at:201:523; Interrogation_Position=3282; Antisense; GGGCGCTGCCGTACAAGGACAAGCC
>probe:Drosophila_2:1633466_at:219:161; Interrogation_Position=3300; Antisense; ACAAGCCCAAGCTGGGACCGGAGAA
>probe:Drosophila_2:1633466_at:473:415; Interrogation_Position=3341; Antisense; GAGCGCGTGGCCGTGGTTAACTCAC
>probe:Drosophila_2:1633466_at:35:519; Interrogation_Position=3353; Antisense; GTGGTTAACTCACCGTACGAGCAGA
>probe:Drosophila_2:1633466_at:114:69; Interrogation_Position=3491; Antisense; ATGGCTTCCCAGGAGCGGCGTCAAA
>probe:Drosophila_2:1633466_at:587:297; Interrogation_Position=3524; Antisense; CGCAAGAAGGTATCGCGGGCCATCA
>probe:Drosophila_2:1633466_at:2:407; Interrogation_Position=3568; Antisense; GACTGCCTGATTTTATTCTCGAGAG
>probe:Drosophila_2:1633466_at:184:585; Interrogation_Position=3600; Antisense; TGGACAATTCTTAGGCATTTTGCTG

Paste this into a BLAST search page for me
AAGTGCCTCGGTTCTATGCTCCTGTTGCTGCCGCTGGACCAGAAGAGCCAGCATGAAGACGCTCGGTCAACTCAAAAAATGCAGCCCAGCCCGACAGTATGTATGTACACAACGATCGTGCGCAAGCAAGGAGAAAATTTTCCGCCCACTGGGCGCTGCCGTACAAGGACAAGCCACAAGCCCAAGCTGGGACCGGAGAAGAGCGCGTGGCCGTGGTTAACTCACGTGGTTAACTCACCGTACGAGCAGAATGGCTTCCCAGGAGCGGCGTCAAACGCAAGAAGGTATCGCGGGCCATCAGACTGCCTGATTTTATTCTCGAGAGTGGACAATTCTTAGGCATTTTGCTG

Full Affymetrix probeset data:

Annotations for 1633466_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720