Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633470_at:

>probe:Drosophila_2:1633470_at:33:325; Interrogation_Position=1560; Antisense; GCGCAACGGGTGATGGATACTCAAT
>probe:Drosophila_2:1633470_at:677:425; Interrogation_Position=1595; Antisense; GAGAGTATCACTAGCTTAGCCACCT
>probe:Drosophila_2:1633470_at:250:27; Interrogation_Position=1629; Antisense; ATAGCAGCTACTCGCTGTACAGCAA
>probe:Drosophila_2:1633470_at:298:111; Interrogation_Position=1649; Antisense; AGCAATGGATTTGTGGTGACCACTA
>probe:Drosophila_2:1633470_at:435:457; Interrogation_Position=1676; Antisense; GATAGTGAACAAGATCCCGCCCGCA
>probe:Drosophila_2:1633470_at:117:99; Interrogation_Position=1704; Antisense; AGAGTATCCACAATCTCAGCTACCT
>probe:Drosophila_2:1633470_at:229:197; Interrogation_Position=1754; Antisense; AACGGGCTGCAGCATATGCGGCACA
>probe:Drosophila_2:1633470_at:663:51; Interrogation_Position=1769; Antisense; ATGCGGCACAGCTTTAGCAGCGATA
>probe:Drosophila_2:1633470_at:60:675; Interrogation_Position=1792; Antisense; TAGCGACAGTCGCAATCGCATCGAT
>probe:Drosophila_2:1633470_at:468:43; Interrogation_Position=1806; Antisense; ATCGCATCGATCTGGATCAGGCACT
>probe:Drosophila_2:1633470_at:577:563; Interrogation_Position=1831; Antisense; GGAAGTGCTCCAGCGACAGCAGCTG
>probe:Drosophila_2:1633470_at:85:213; Interrogation_Position=1868; Antisense; AAGACTCCCAGCAGCCAGGTGGTGT
>probe:Drosophila_2:1633470_at:411:127; Interrogation_Position=1880; Antisense; AGCCAGGTGGTGTATATCGTGCAAA
>probe:Drosophila_2:1633470_at:470:447; Interrogation_Position=1967; Antisense; GATGCGCTGAGCGTGGAGAACACAC

Paste this into a BLAST search page for me
GCGCAACGGGTGATGGATACTCAATGAGAGTATCACTAGCTTAGCCACCTATAGCAGCTACTCGCTGTACAGCAAAGCAATGGATTTGTGGTGACCACTAGATAGTGAACAAGATCCCGCCCGCAAGAGTATCCACAATCTCAGCTACCTAACGGGCTGCAGCATATGCGGCACAATGCGGCACAGCTTTAGCAGCGATATAGCGACAGTCGCAATCGCATCGATATCGCATCGATCTGGATCAGGCACTGGAAGTGCTCCAGCGACAGCAGCTGAAGACTCCCAGCAGCCAGGTGGTGTAGCCAGGTGGTGTATATCGTGCAAAGATGCGCTGAGCGTGGAGAACACAC

Full Affymetrix probeset data:

Annotations for 1633470_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime