FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633471_at:

>probe:Drosophila_2:1633471_at:577:353; Interrogation_Position=743; Antisense; GCACCACTGACAACTACTGACACAA
>probe:Drosophila_2:1633471_at:2:613; Interrogation_Position=750; Antisense; TGACAACTACTGACACAAAACCGTT
>probe:Drosophila_2:1633471_at:469:669; Interrogation_Position=757; Antisense; TACTGACACAAAACCGTTCCCCATT
>probe:Drosophila_2:1633471_at:397:611; Interrogation_Position=760; Antisense; TGACACAAAACCGTTCCCCATTTGT
>probe:Drosophila_2:1633471_at:21:173; Interrogation_Position=767; Antisense; AAACCGTTCCCCATTTGTGATCCAT
>probe:Drosophila_2:1633471_at:148:469; Interrogation_Position=772; Antisense; GTTCCCCATTTGTGATCCATTCAAT
>probe:Drosophila_2:1633471_at:527:633; Interrogation_Position=774; Antisense; TCCCCATTTGTGATCCATTCAATAA
>probe:Drosophila_2:1633471_at:317:513; Interrogation_Position=783; Antisense; GTGATCCATTCAATAATGTGCCGTA
>probe:Drosophila_2:1633471_at:674:249; Interrogation_Position=793; Antisense; CAATAATGTGCCGTATTTCCTGACA
>probe:Drosophila_2:1633471_at:93:657; Interrogation_Position=796; Antisense; TAATGTGCCGTATTTCCTGACATAT
>probe:Drosophila_2:1633471_at:206:597; Interrogation_Position=799; Antisense; TGTGCCGTATTTCCTGACATATACT
>probe:Drosophila_2:1633471_at:605:317; Interrogation_Position=802; Antisense; GCCGTATTTCCTGACATATACTATA
>probe:Drosophila_2:1633471_at:531:29; Interrogation_Position=819; Antisense; ATACTATATACTATGTGCAGTTCAT
>probe:Drosophila_2:1633471_at:125:667; Interrogation_Position=827; Antisense; TACTATGTGCAGTTCATTTATTTAA

Paste this into a BLAST search page for me
GCACCACTGACAACTACTGACACAATGACAACTACTGACACAAAACCGTTTACTGACACAAAACCGTTCCCCATTTGACACAAAACCGTTCCCCATTTGTAAACCGTTCCCCATTTGTGATCCATGTTCCCCATTTGTGATCCATTCAATTCCCCATTTGTGATCCATTCAATAAGTGATCCATTCAATAATGTGCCGTACAATAATGTGCCGTATTTCCTGACATAATGTGCCGTATTTCCTGACATATTGTGCCGTATTTCCTGACATATACTGCCGTATTTCCTGACATATACTATAATACTATATACTATGTGCAGTTCATTACTATGTGCAGTTCATTTATTTAA

Full Affymetrix probeset data:

Annotations for 1633471_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720