Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633474_x_at:

>probe:Drosophila_2:1633474_x_at:712:631; Interrogation_Position=1009; Antisense; TCCGGCTGTGTCCAGCTACTCGGCT
>probe:Drosophila_2:1633474_x_at:399:333; Interrogation_Position=1037; Antisense; GCTGTGGTCAGCAGCTACTCCGGAT
>probe:Drosophila_2:1633474_x_at:222:519; Interrogation_Position=1040; Antisense; GTGGTCAGCAGCTACTCCGGATCCT
>probe:Drosophila_2:1633474_x_at:19:545; Interrogation_Position=1058; Antisense; GGATCCTCCGGCACCGTGTACGGCT
>probe:Drosophila_2:1633474_x_at:252:1; Interrogation_Position=1081; Antisense; CTCCAACGGCGGATACGTCTACTAA
>probe:Drosophila_2:1633474_x_at:334:625; Interrogation_Position=538; Antisense; TGCCGTGTCCGGATACTCTCAGACC
>probe:Drosophila_2:1633474_x_at:369:515; Interrogation_Position=542; Antisense; GTGTCCGGATACTCTCAGACCTACA
>probe:Drosophila_2:1633474_x_at:280:665; Interrogation_Position=614; Antisense; TACACCGCCCCAGTGGTGACCAAGA
>probe:Drosophila_2:1633474_x_at:521:467; Interrogation_Position=653; Antisense; GTTGTGGCCAAGACCTACACTGCTC
>probe:Drosophila_2:1633474_x_at:520:467; Interrogation_Position=704; Antisense; GTTGTGGCCAAGACCTATACCGCTC
>probe:Drosophila_2:1633474_x_at:371:519; Interrogation_Position=734; Antisense; GTGGTCAAGACCTACTCTGCCCCAG
>probe:Drosophila_2:1633474_x_at:281:665; Interrogation_Position=821; Antisense; TACACCGCTCCTGTGGTGACCAAGA
>probe:Drosophila_2:1633474_x_at:395:533; Interrogation_Position=988; Antisense; GGTGACCAAGACCTATTCCGCTCCG
>probe:Drosophila_2:1633474_x_at:598:103; Interrogation_Position=996; Antisense; AGACCTATTCCGCTCCGGCTGTGTC

Paste this into a BLAST search page for me
TCCGGCTGTGTCCAGCTACTCGGCTGCTGTGGTCAGCAGCTACTCCGGATGTGGTCAGCAGCTACTCCGGATCCTGGATCCTCCGGCACCGTGTACGGCTCTCCAACGGCGGATACGTCTACTAATGCCGTGTCCGGATACTCTCAGACCGTGTCCGGATACTCTCAGACCTACATACACCGCCCCAGTGGTGACCAAGAGTTGTGGCCAAGACCTACACTGCTCGTTGTGGCCAAGACCTATACCGCTCGTGGTCAAGACCTACTCTGCCCCAGTACACCGCTCCTGTGGTGACCAAGAGGTGACCAAGACCTATTCCGCTCCGAGACCTATTCCGCTCCGGCTGTGTC

Full Affymetrix probeset data:

Annotations for 1633474_x_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime