FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633476_at:

>probe:Drosophila_2:1633476_at:673:265; Interrogation_Position=1682; Antisense; CAGTCTCAAGGTGTGGCGGCCAATA
>probe:Drosophila_2:1633476_at:311:527; Interrogation_Position=1711; Antisense; GGGAATCGAACTGACTCGTGCAGCT
>probe:Drosophila_2:1633476_at:391:69; Interrogation_Position=1743; Antisense; ATGGCCGGCAGTTTGTGTGCCAAAC
>probe:Drosophila_2:1633476_at:247:383; Interrogation_Position=1834; Antisense; GAACGTGCTGGAACTATTTCTGGTC
>probe:Drosophila_2:1633476_at:631:17; Interrogation_Position=1849; Antisense; ATTTCTGGTCCAAACGGTGCTTAAT
>probe:Drosophila_2:1633476_at:645:51; Interrogation_Position=1911; Antisense; ATGCGGATCTGCGATCGCTGCAAAA
>probe:Drosophila_2:1633476_at:171:275; Interrogation_Position=1939; Antisense; CTTGGAGGATTCACTGGCGCAGTTC
>probe:Drosophila_2:1633476_at:498:439; Interrogation_Position=1988; Antisense; GATGGATTCGAGTTCCACGACCGTG
>probe:Drosophila_2:1633476_at:657:411; Interrogation_Position=2006; Antisense; GACCGTGTGCTAAACTCCGTGCTGG
>probe:Drosophila_2:1633476_at:358:229; Interrogation_Position=2045; Antisense; AATGTGTATCCCAGGCTCTTCGATT
>probe:Drosophila_2:1633476_at:460:463; Interrogation_Position=2066; Antisense; GATTCGGCCAAACGCAGCACCATGA
>probe:Drosophila_2:1633476_at:489:379; Interrogation_Position=2095; Antisense; GAAGCCCGTCCAAACATCATTTGAG
>probe:Drosophila_2:1633476_at:685:33; Interrogation_Position=2110; Antisense; ATCATTTGAGACCTACCTGAAGCCC
>probe:Drosophila_2:1633476_at:510:411; Interrogation_Position=2165; Antisense; GACCGACCCGAGTCATGTGTATAGA

Paste this into a BLAST search page for me
CAGTCTCAAGGTGTGGCGGCCAATAGGGAATCGAACTGACTCGTGCAGCTATGGCCGGCAGTTTGTGTGCCAAACGAACGTGCTGGAACTATTTCTGGTCATTTCTGGTCCAAACGGTGCTTAATATGCGGATCTGCGATCGCTGCAAAACTTGGAGGATTCACTGGCGCAGTTCGATGGATTCGAGTTCCACGACCGTGGACCGTGTGCTAAACTCCGTGCTGGAATGTGTATCCCAGGCTCTTCGATTGATTCGGCCAAACGCAGCACCATGAGAAGCCCGTCCAAACATCATTTGAGATCATTTGAGACCTACCTGAAGCCCGACCGACCCGAGTCATGTGTATAGA

Full Affymetrix probeset data:

Annotations for 1633476_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720