FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633477_at:

>probe:Drosophila_2:1633477_at:182:305; Interrogation_Position=2408; Antisense; CCTGGCAGAAATCCGCTTACAAGCT
>probe:Drosophila_2:1633477_at:465:153; Interrogation_Position=2447; Antisense; ACATGATGTCGACCCGTTTGCTGGA
>probe:Drosophila_2:1633477_at:87:437; Interrogation_Position=2485; Antisense; GAGGAGTACGACACCACACGAGACG
>probe:Drosophila_2:1633477_at:252:563; Interrogation_Position=2553; Antisense; GGAACCTGAACAACGCATGGCCAAT
>probe:Drosophila_2:1633477_at:455:559; Interrogation_Position=2583; Antisense; GGAACAATTGCCCAGTCAGACAGTG
>probe:Drosophila_2:1633477_at:397:265; Interrogation_Position=2646; Antisense; CATGGTTCCCGGTACAAGTCTACCA
>probe:Drosophila_2:1633477_at:188:25; Interrogation_Position=2676; Antisense; ATATGGCGCCACTACAGCGAACTAT
>probe:Drosophila_2:1633477_at:201:123; Interrogation_Position=2691; Antisense; AGCGAACTATTCAGTCATTCCAGCC
>probe:Drosophila_2:1633477_at:456:719; Interrogation_Position=2708; Antisense; TTCCAGCCCTTAATTCCGATCAGGA
>probe:Drosophila_2:1633477_at:474:41; Interrogation_Position=2734; Antisense; ATCGGAGAGCGCCTTTTGAGTCCCA
>probe:Drosophila_2:1633477_at:171:365; Interrogation_Position=2764; Antisense; GAATCGCCTGTTGAATTTGGCCGCG
>probe:Drosophila_2:1633477_at:538:581; Interrogation_Position=2781; Antisense; TGGCCGCGAGTATTCTATCTTGCTG
>probe:Drosophila_2:1633477_at:118:321; Interrogation_Position=2805; Antisense; GCCCGGCCAGAATACTATCATCGAG
>probe:Drosophila_2:1633477_at:36:687; Interrogation_Position=2820; Antisense; TATCATCGAGGACTATCCCTGTGCC

Paste this into a BLAST search page for me
CCTGGCAGAAATCCGCTTACAAGCTACATGATGTCGACCCGTTTGCTGGAGAGGAGTACGACACCACACGAGACGGGAACCTGAACAACGCATGGCCAATGGAACAATTGCCCAGTCAGACAGTGCATGGTTCCCGGTACAAGTCTACCAATATGGCGCCACTACAGCGAACTATAGCGAACTATTCAGTCATTCCAGCCTTCCAGCCCTTAATTCCGATCAGGAATCGGAGAGCGCCTTTTGAGTCCCAGAATCGCCTGTTGAATTTGGCCGCGTGGCCGCGAGTATTCTATCTTGCTGGCCCGGCCAGAATACTATCATCGAGTATCATCGAGGACTATCCCTGTGCC

Full Affymetrix probeset data:

Annotations for 1633477_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720