Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633479_a_at:

>probe:Drosophila_2:1633479_a_at:217:325; Interrogation_Position=110; Antisense; GCGAAGAGAAACGTAGCGCCCATTC
>probe:Drosophila_2:1633479_a_at:603:221; Interrogation_Position=179; Antisense; AAGGGCAACAACGAGCTCTTCCTGA
>probe:Drosophila_2:1633479_a_at:240:369; Interrogation_Position=202; Antisense; GAAGGAGGTCTTCAATACCACCAAT
>probe:Drosophila_2:1633479_a_at:717:241; Interrogation_Position=228; Antisense; AATATCGGGCAATGCACGGCTGTCC
>probe:Drosophila_2:1633479_a_at:646:297; Interrogation_Position=253; Antisense; CGCGGTGACCATTAATGCTGCACTA
>probe:Drosophila_2:1633479_a_at:89:565; Interrogation_Position=292; Antisense; GGAATGGGCCAATCATCTCCGCGAT
>probe:Drosophila_2:1633479_a_at:105:455; Interrogation_Position=314; Antisense; GATCAGAACACAATGGCGCACAGAC
>probe:Drosophila_2:1633479_a_at:110:3; Interrogation_Position=340; Antisense; CAATCCCAAGTACGGCGAAAACATT
>probe:Drosophila_2:1633479_a_at:54:29; Interrogation_Position=358; Antisense; AAACATTTTCCTCTCCGGTGGAATG
>probe:Drosophila_2:1633479_a_at:46:453; Interrogation_Position=395; Antisense; GATCTGCCGGTGGAAATGTGGTATC
>probe:Drosophila_2:1633479_a_at:571:239; Interrogation_Position=428; Antisense; AATAGCTACGATTTCAACAAGGCGC
>probe:Drosophila_2:1633479_a_at:541:651; Interrogation_Position=441; Antisense; TCAACAAGGCGCAGTTTGTGCCCAC
>probe:Drosophila_2:1633479_a_at:288:647; Interrogation_Position=481; Antisense; TCAGCTCATTTGGAAGTCGTCGGTG
>probe:Drosophila_2:1633479_a_at:414:487; Interrogation_Position=66; Antisense; GGTTAACTAAATCACGGCGCCAGCC

Paste this into a BLAST search page for me
GCGAAGAGAAACGTAGCGCCCATTCAAGGGCAACAACGAGCTCTTCCTGAGAAGGAGGTCTTCAATACCACCAATAATATCGGGCAATGCACGGCTGTCCCGCGGTGACCATTAATGCTGCACTAGGAATGGGCCAATCATCTCCGCGATGATCAGAACACAATGGCGCACAGACCAATCCCAAGTACGGCGAAAACATTAAACATTTTCCTCTCCGGTGGAATGGATCTGCCGGTGGAAATGTGGTATCAATAGCTACGATTTCAACAAGGCGCTCAACAAGGCGCAGTTTGTGCCCACTCAGCTCATTTGGAAGTCGTCGGTGGGTTAACTAAATCACGGCGCCAGCC

Full Affymetrix probeset data:

Annotations for 1633479_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime