Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633480_at:

>probe:Drosophila_2:1633480_at:517:711; Interrogation_Position=3710; Antisense; TTCTTGGTGCCAATTAACCCGTTAT
>probe:Drosophila_2:1633480_at:548:439; Interrogation_Position=3743; Antisense; GATGGAAAGTGCCTTCAACTGTAAG
>probe:Drosophila_2:1633480_at:54:249; Interrogation_Position=3769; Antisense; AATTGACCCTCTGTACCATGTGATA
>probe:Drosophila_2:1633480_at:471:699; Interrogation_Position=3845; Antisense; TTTATGCCAGGGTCCGTAAATCACC
>probe:Drosophila_2:1633480_at:442:245; Interrogation_Position=3911; Antisense; AATTCAAATCATTGCTCCATGGTAA
>probe:Drosophila_2:1633480_at:476:441; Interrogation_Position=3991; Antisense; GATGGACCAAAACTCGACACTGTGC
>probe:Drosophila_2:1633480_at:476:399; Interrogation_Position=4006; Antisense; GACACTGTGCCCTAACCATGTGGAA
>probe:Drosophila_2:1633480_at:567:685; Interrogation_Position=4059; Antisense; TATAATTATTTTTTGGTCCCTGGCT
>probe:Drosophila_2:1633480_at:521:533; Interrogation_Position=4073; Antisense; GGTCCCTGGCTAGGAGTTCGTTAAT
>probe:Drosophila_2:1633480_at:143:213; Interrogation_Position=4095; Antisense; AATGACCAAAGCATTGTCCGCCTAG
>probe:Drosophila_2:1633480_at:433:501; Interrogation_Position=4110; Antisense; GTCCGCCTAGGAGTATCGCTAGTCT
>probe:Drosophila_2:1633480_at:435:377; Interrogation_Position=4172; Antisense; GAAGCATGGCTTCCTTTATTGAACC
>probe:Drosophila_2:1633480_at:534:723; Interrogation_Position=4190; Antisense; TTGAACCACTCCATATAGATCCTGC
>probe:Drosophila_2:1633480_at:50:27; Interrogation_Position=4204; Antisense; ATAGATCCTGCCGAAGCTTTATTAT

Paste this into a BLAST search page for me
TTCTTGGTGCCAATTAACCCGTTATGATGGAAAGTGCCTTCAACTGTAAGAATTGACCCTCTGTACCATGTGATATTTATGCCAGGGTCCGTAAATCACCAATTCAAATCATTGCTCCATGGTAAGATGGACCAAAACTCGACACTGTGCGACACTGTGCCCTAACCATGTGGAATATAATTATTTTTTGGTCCCTGGCTGGTCCCTGGCTAGGAGTTCGTTAATAATGACCAAAGCATTGTCCGCCTAGGTCCGCCTAGGAGTATCGCTAGTCTGAAGCATGGCTTCCTTTATTGAACCTTGAACCACTCCATATAGATCCTGCATAGATCCTGCCGAAGCTTTATTAT

Full Affymetrix probeset data:

Annotations for 1633480_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime