Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633483_a_at:

>probe:Drosophila_2:1633483_a_at:122:463; Interrogation_Position=1021; Antisense; GATTAAATCCATACACACATTGAGT
>probe:Drosophila_2:1633483_a_at:434:721; Interrogation_Position=1040; Antisense; TTGAGTTTAATCCAATCCTATCTAA
>probe:Drosophila_2:1633483_a_at:560:147; Interrogation_Position=1099; Antisense; ACTATGTTACTGACGTACTACTCAT
>probe:Drosophila_2:1633483_a_at:57:83; Interrogation_Position=637; Antisense; AGTGCTGAAGCTGCGTTTCGATGTC
>probe:Drosophila_2:1633483_a_at:292:479; Interrogation_Position=651; Antisense; GTTTCGATGTCAGCCAGTATGCGCC
>probe:Drosophila_2:1633483_a_at:251:625; Interrogation_Position=670; Antisense; TGCGCCCGAGGAAATTGTTGTGAAA
>probe:Drosophila_2:1633483_a_at:104:389; Interrogation_Position=691; Antisense; GAAAACCGTCGACCAGAAGCTATTG
>probe:Drosophila_2:1633483_a_at:603:117; Interrogation_Position=708; Antisense; AGCTATTGGTGCACGCCAAGCACGA
>probe:Drosophila_2:1633483_a_at:611:317; Interrogation_Position=875; Antisense; GCCGGCGAGACACTGATTCCCATTG
>probe:Drosophila_2:1633483_a_at:224:285; Interrogation_Position=887; Antisense; CTGATTCCCATTGCGCACAAGTGAA
>probe:Drosophila_2:1633483_a_at:308:161; Interrogation_Position=903; Antisense; ACAAGTGAAGGCCAGCCCAGTTGTC
>probe:Drosophila_2:1633483_a_at:279:95; Interrogation_Position=921; Antisense; AGTTGTCCAGTTGTCCAGCTATCCA
>probe:Drosophila_2:1633483_a_at:89:599; Interrogation_Position=932; Antisense; TGTCCAGCTATCCAGTCACCATGGT
>probe:Drosophila_2:1633483_a_at:29:129; Interrogation_Position=949; Antisense; ACCATGGTCCCAAGCCGGTTGAGGA

Paste this into a BLAST search page for me
GATTAAATCCATACACACATTGAGTTTGAGTTTAATCCAATCCTATCTAAACTATGTTACTGACGTACTACTCATAGTGCTGAAGCTGCGTTTCGATGTCGTTTCGATGTCAGCCAGTATGCGCCTGCGCCCGAGGAAATTGTTGTGAAAGAAAACCGTCGACCAGAAGCTATTGAGCTATTGGTGCACGCCAAGCACGAGCCGGCGAGACACTGATTCCCATTGCTGATTCCCATTGCGCACAAGTGAAACAAGTGAAGGCCAGCCCAGTTGTCAGTTGTCCAGTTGTCCAGCTATCCATGTCCAGCTATCCAGTCACCATGGTACCATGGTCCCAAGCCGGTTGAGGA

Full Affymetrix probeset data:

Annotations for 1633483_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime