FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633484_at:

>probe:Drosophila_2:1633484_at:124:83; Interrogation_Position=1051; Antisense; AGGGCGCAATCCAACAATGCCGAGA
>probe:Drosophila_2:1633484_at:538:729; Interrogation_Position=1155; Antisense; TTGGCAACGGCGAACCATTGAGGCA
>probe:Drosophila_2:1633484_at:608:165; Interrogation_Position=1179; Antisense; AAATCGCCGTGAATTCCTGGCCAAT
>probe:Drosophila_2:1633484_at:331:577; Interrogation_Position=1197; Antisense; GGCCAATTTACCCAACCTAAGTGAG
>probe:Drosophila_2:1633484_at:116:669; Interrogation_Position=640; Antisense; TACTCGGCCCAGATTCAGATTTTTA
>probe:Drosophila_2:1633484_at:67:89; Interrogation_Position=681; Antisense; AGTCAAATCAGTTTGGCCCACCGAA
>probe:Drosophila_2:1633484_at:501:581; Interrogation_Position=694; Antisense; TGGCCCACCGAAAGACCTGATATAT
>probe:Drosophila_2:1633484_at:355:447; Interrogation_Position=739; Antisense; GATGCTCCTTCAAATATCACCTGGG
>probe:Drosophila_2:1633484_at:642:171; Interrogation_Position=768; Antisense; AAAGAGCCATCTCAACGTGACCGTC
>probe:Drosophila_2:1633484_at:368:411; Interrogation_Position=786; Antisense; GACCGTCTCTCATGTGGCGGATCAT
>probe:Drosophila_2:1633484_at:474:547; Interrogation_Position=870; Antisense; GGATGTGCTTAAACCAGCGGTGCTC
>probe:Drosophila_2:1633484_at:568:121; Interrogation_Position=885; Antisense; AGCGGTGCTCGATGTTATCCAGGGC
>probe:Drosophila_2:1633484_at:5:81; Interrogation_Position=923; Antisense; AGGGTCGCCCTGTTCAGAATCTAAT
>probe:Drosophila_2:1633484_at:86:655; Interrogation_Position=944; Antisense; TAATTCCTCAGCATTTTCCCATAGT

Paste this into a BLAST search page for me
AGGGCGCAATCCAACAATGCCGAGATTGGCAACGGCGAACCATTGAGGCAAAATCGCCGTGAATTCCTGGCCAATGGCCAATTTACCCAACCTAAGTGAGTACTCGGCCCAGATTCAGATTTTTAAGTCAAATCAGTTTGGCCCACCGAATGGCCCACCGAAAGACCTGATATATGATGCTCCTTCAAATATCACCTGGGAAAGAGCCATCTCAACGTGACCGTCGACCGTCTCTCATGTGGCGGATCATGGATGTGCTTAAACCAGCGGTGCTCAGCGGTGCTCGATGTTATCCAGGGCAGGGTCGCCCTGTTCAGAATCTAATTAATTCCTCAGCATTTTCCCATAGT

Full Affymetrix probeset data:

Annotations for 1633484_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720