FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633486_at:

>probe:Drosophila_2:1633486_at:415:539; Interrogation_Position=1067; Antisense; GGTACGAACAGGTGCACAACTTCAA
>probe:Drosophila_2:1633486_at:631:267; Interrogation_Position=638; Antisense; CAGGCACTCCACTAAATGTCAACCA
>probe:Drosophila_2:1633486_at:60:61; Interrogation_Position=653; Antisense; ATGTCAACCACTTTCGCGTTGGTGA
>probe:Drosophila_2:1633486_at:426:403; Interrogation_Position=676; Antisense; GACTTCGTCGATGTTCGCGGCAAAA
>probe:Drosophila_2:1633486_at:164:179; Interrogation_Position=698; Antisense; AAACAGTTGACCATGGCTTCCAAGG
>probe:Drosophila_2:1633486_at:401:157; Interrogation_Position=735; Antisense; ACACGGATTTAAGGGCATGCCAGCA
>probe:Drosophila_2:1633486_at:162:313; Interrogation_Position=753; Antisense; GCCAGCATCGCACGGTGTGACGAAA
>probe:Drosophila_2:1633486_at:158:389; Interrogation_Position=774; Antisense; GAAAACTCATCGACGTGCCGGCAAC
>probe:Drosophila_2:1633486_at:278:221; Interrogation_Position=817; Antisense; AAGGGTCGCGTCTGGCCAGGCACAA
>probe:Drosophila_2:1633486_at:576:205; Interrogation_Position=841; Antisense; AAGATGCCGGGACACATGGGAAACC
>probe:Drosophila_2:1633486_at:434:593; Interrogation_Position=857; Antisense; TGGGAAACCGGTGGCGCATCATCAA
>probe:Drosophila_2:1633486_at:341:323; Interrogation_Position=888; Antisense; GCGCGTGTGGCGCATTAACACCAAA
>probe:Drosophila_2:1633486_at:281:575; Interrogation_Position=958; Antisense; GGCGGTCTGGTCTACATATACGATA
>probe:Drosophila_2:1633486_at:37:19; Interrogation_Position=973; Antisense; ATATACGATACCATCTTGCCAACGC

Paste this into a BLAST search page for me
GGTACGAACAGGTGCACAACTTCAACAGGCACTCCACTAAATGTCAACCAATGTCAACCACTTTCGCGTTGGTGAGACTTCGTCGATGTTCGCGGCAAAAAAACAGTTGACCATGGCTTCCAAGGACACGGATTTAAGGGCATGCCAGCAGCCAGCATCGCACGGTGTGACGAAAGAAAACTCATCGACGTGCCGGCAACAAGGGTCGCGTCTGGCCAGGCACAAAAGATGCCGGGACACATGGGAAACCTGGGAAACCGGTGGCGCATCATCAAGCGCGTGTGGCGCATTAACACCAAAGGCGGTCTGGTCTACATATACGATAATATACGATACCATCTTGCCAACGC

Full Affymetrix probeset data:

Annotations for 1633486_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720