Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633487_at:

>probe:Drosophila_2:1633487_at:692:443; Interrogation_Position=109; Antisense; GATGACTCGGGCTGCGCGCCGATTT
>probe:Drosophila_2:1633487_at:480:297; Interrogation_Position=123; Antisense; CGCGCCGATTTTCCGGGTCTATCAG
>probe:Drosophila_2:1633487_at:173:535; Interrogation_Position=138; Antisense; GGTCTATCAGGAGTGCGTCAAGCGC
>probe:Drosophila_2:1633487_at:300:495; Interrogation_Position=154; Antisense; GTCAAGCGCGCCATGAGGGAGCAAA
>probe:Drosophila_2:1633487_at:516:547; Interrogation_Position=192; Antisense; GGAGGTCGGATCTGAGTACTGCACC
>probe:Drosophila_2:1633487_at:198:41; Interrogation_Position=201; Antisense; ATCTGAGTACTGCACCGGCTCGGAG
>probe:Drosophila_2:1633487_at:540:615; Interrogation_Position=211; Antisense; TGCACCGGCTCGGAGTACGACAATG
>probe:Drosophila_2:1633487_at:166:397; Interrogation_Position=229; Antisense; GACAATGCGAGTAGTTCCGGCGGAA
>probe:Drosophila_2:1633487_at:147:711; Interrogation_Position=243; Antisense; TTCCGGCGGAAAGACGCAACCCAAG
>probe:Drosophila_2:1633487_at:335:377; Interrogation_Position=48; Antisense; GAAGCAGTACGACGCCTGCTTCAAC
>probe:Drosophila_2:1633487_at:598:283; Interrogation_Position=63; Antisense; CTGCTTCAACAGCTGGTTCTCGGAA
>probe:Drosophila_2:1633487_at:88:121; Interrogation_Position=73; Antisense; AGCTGGTTCTCGGAAGGCTTCCTTA
>probe:Drosophila_2:1633487_at:552:1; Interrogation_Position=87; Antisense; AGGCTTCCTTAAGGGCCAGACGGAT
>probe:Drosophila_2:1633487_at:615:269; Interrogation_Position=94; Antisense; CTTAAGGGCCAGACGGATGACTCGG

Paste this into a BLAST search page for me
GATGACTCGGGCTGCGCGCCGATTTCGCGCCGATTTTCCGGGTCTATCAGGGTCTATCAGGAGTGCGTCAAGCGCGTCAAGCGCGCCATGAGGGAGCAAAGGAGGTCGGATCTGAGTACTGCACCATCTGAGTACTGCACCGGCTCGGAGTGCACCGGCTCGGAGTACGACAATGGACAATGCGAGTAGTTCCGGCGGAATTCCGGCGGAAAGACGCAACCCAAGGAAGCAGTACGACGCCTGCTTCAACCTGCTTCAACAGCTGGTTCTCGGAAAGCTGGTTCTCGGAAGGCTTCCTTAAGGCTTCCTTAAGGGCCAGACGGATCTTAAGGGCCAGACGGATGACTCGG

Full Affymetrix probeset data:

Annotations for 1633487_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime