FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633488_at:

>probe:Drosophila_2:1633488_at:152:41; Interrogation_Position=1001; Antisense; ATCTGGAGGCCGTACCGCCAGCCAA
>probe:Drosophila_2:1633488_at:484:277; Interrogation_Position=1026; Antisense; CTACTTTATAGGTTTCGGTGGCAAT
>probe:Drosophila_2:1633488_at:581:79; Interrogation_Position=1064; Antisense; AGGTCTATCGCCGTGCACAGTATTA
>probe:Drosophila_2:1633488_at:229:705; Interrogation_Position=1086; Antisense; TTACGTAACGGATTTTGAGCAGCTG
>probe:Drosophila_2:1633488_at:677:475; Interrogation_Position=1179; Antisense; GTTATAGCTCGTAGTGATGCACATG
>probe:Drosophila_2:1633488_at:468:513; Interrogation_Position=1192; Antisense; GTGATGCACATGTTTATGCCCAAGT
>probe:Drosophila_2:1633488_at:647:109; Interrogation_Position=1325; Antisense; AGAATATGTTAAGCGCGCACTGTTA
>probe:Drosophila_2:1633488_at:151:125; Interrogation_Position=1336; Antisense; AGCGCGCACTGTTAGTGAATCAGCA
>probe:Drosophila_2:1633488_at:66:703; Interrogation_Position=1365; Antisense; TTGTAAAAATACAGGGTGCGCCCTT
>probe:Drosophila_2:1633488_at:629:533; Interrogation_Position=1379; Antisense; GGTGCGCCCTTATGCTAATGAACAG
>probe:Drosophila_2:1633488_at:542:385; Interrogation_Position=1398; Antisense; GAACAGTTCACGCTTTAGCATCCAA
>probe:Drosophila_2:1633488_at:111:705; Interrogation_Position=1412; Antisense; TTAGCATCCAACTGTAAGCAATTTA
>probe:Drosophila_2:1633488_at:257:9; Interrogation_Position=965; Antisense; ATTCCCTAATCACCATGATCGGCGA
>probe:Drosophila_2:1633488_at:285:265; Interrogation_Position=978; Antisense; CATGATCGGCGATGGAGCCACCGAT

Paste this into a BLAST search page for me
ATCTGGAGGCCGTACCGCCAGCCAACTACTTTATAGGTTTCGGTGGCAATAGGTCTATCGCCGTGCACAGTATTATTACGTAACGGATTTTGAGCAGCTGGTTATAGCTCGTAGTGATGCACATGGTGATGCACATGTTTATGCCCAAGTAGAATATGTTAAGCGCGCACTGTTAAGCGCGCACTGTTAGTGAATCAGCATTGTAAAAATACAGGGTGCGCCCTTGGTGCGCCCTTATGCTAATGAACAGGAACAGTTCACGCTTTAGCATCCAATTAGCATCCAACTGTAAGCAATTTAATTCCCTAATCACCATGATCGGCGACATGATCGGCGATGGAGCCACCGAT

Full Affymetrix probeset data:

Annotations for 1633488_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720