Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633489_at:

>probe:Drosophila_2:1633489_at:596:359; Interrogation_Position=3438; Antisense; GCAAGCTGAACTTTAGACTGCACTT
>probe:Drosophila_2:1633489_at:188:677; Interrogation_Position=3451; Antisense; TAGACTGCACTTGAGCTTAGCTTTC
>probe:Drosophila_2:1633489_at:440:703; Interrogation_Position=3461; Antisense; TTGAGCTTAGCTTTCGGGTACCGTA
>probe:Drosophila_2:1633489_at:538:639; Interrogation_Position=3474; Antisense; TCGGGTACCGTAGTGCATTTTAAAG
>probe:Drosophila_2:1633489_at:141:657; Interrogation_Position=3543; Antisense; TAAGTCAATACTAATACCCGTTACT
>probe:Drosophila_2:1633489_at:552:457; Interrogation_Position=3590; Antisense; GATTAGTGGAATCGTTTGTAACATT
>probe:Drosophila_2:1633489_at:126:223; Interrogation_Position=3617; Antisense; AAGGTATTCATCTGAGTAACGGGTA
>probe:Drosophila_2:1633489_at:446:291; Interrogation_Position=3651; Antisense; CGAGAGAATCGACTATAACTTTATT
>probe:Drosophila_2:1633489_at:388:725; Interrogation_Position=3676; Antisense; TTGTTTGTTTTCTCCTTTCAGAATG
>probe:Drosophila_2:1633489_at:502:21; Interrogation_Position=3755; Antisense; ATATTTTGTAACATCCACTGTACAG
>probe:Drosophila_2:1633489_at:710:699; Interrogation_Position=3894; Antisense; TTTTCAAGTCTTGTTTCGGCAATAT
>probe:Drosophila_2:1633489_at:335:359; Interrogation_Position=3940; Antisense; GAATTATTTGAACATTTTTGGCCAA
>probe:Drosophila_2:1633489_at:651:689; Interrogation_Position=3956; Antisense; TTTGGCCAACAAAAATCCAGCGGTA
>probe:Drosophila_2:1633489_at:475:257; Interrogation_Position=4001; Antisense; CACAATTCAATGTATGCAATGGGTA

Paste this into a BLAST search page for me
GCAAGCTGAACTTTAGACTGCACTTTAGACTGCACTTGAGCTTAGCTTTCTTGAGCTTAGCTTTCGGGTACCGTATCGGGTACCGTAGTGCATTTTAAAGTAAGTCAATACTAATACCCGTTACTGATTAGTGGAATCGTTTGTAACATTAAGGTATTCATCTGAGTAACGGGTACGAGAGAATCGACTATAACTTTATTTTGTTTGTTTTCTCCTTTCAGAATGATATTTTGTAACATCCACTGTACAGTTTTCAAGTCTTGTTTCGGCAATATGAATTATTTGAACATTTTTGGCCAATTTGGCCAACAAAAATCCAGCGGTACACAATTCAATGTATGCAATGGGTA

Full Affymetrix probeset data:

Annotations for 1633489_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime